Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transgenic sweet wormwood plant and cultivation method thereof

A transgenic, Artemisia annua technology, applied in the field of metabolic engineering, can solve the problem of difficult to solve the problem of chemical weeding in Artemisia annua fields, and achieve the effect of improving glyphosate resistance

Inactive Publication Date: 2016-02-03
SHANGHAI JIAO TONG UNIV
View PDF8 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for a long time, the problem of chemical weeding in Artemisia annua fields has been difficult to solve

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic sweet wormwood plant and cultivation method thereof
  • Transgenic sweet wormwood plant and cultivation method thereof
  • Transgenic sweet wormwood plant and cultivation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Construction of plant expression vectors containing hmgr, fps, dbr2 and epsps genes

[0037] The map of the plasmid vector pCAMBIA1305.1::p35s-epsps-hmgr-fps-dbr2 that needs to be constructed is as follows figure 1 shown.

[0038] 1. Use PCR to clone hmgr, fps and dbr2 genes from the Artemisia annua genome, and continue to amplify the genes from the artificially synthesized epsps gene fragment.

[0039] PCR primers are:

[0040] hmgr-FP:ATGGATCTCCGTCGTAAACTGCC;

[0041] hmgr-RP: TCACACCTTTGACGCAATTGCTGAC;

[0042] fps-FP: ATGAGTAGTACCGATCTGAAATC;

[0043] fps-RP: CTACTTTTGCCTCTTGTAAATTTTACCC;

[0044] dbr2-FP: ATGTCTGAAAAACCAACCTTGTTTTCTGCC;

[0045] dbr2-RP: CTAGAGGAGTGACCCTTTGTCAAGAG;

[0046] epsps-FP: ATGGCGCAAGTTAGCAGAATCTGC;

[0047] epsps-RP: TTAGTCGTTAAGGTGAACTCCTAG.

[0048] The PCR conditions are:

[0049] hmgr: Pre-denaturation at 95°C for 5min; denaturation at 94°C for 30s; annealing at 55°C for 30s; extension at 68°C for 2min, 35 cycles; extension a...

Embodiment 2

[0087] Agrobacterium tumefaciens mediated hmgr, fps, dbr2 and epsps gene genetic transformation of Artemisia annua to obtain transgenic Artemisia annua plants

[0088] 1. Acquisition of Agrobacterium tumefaciens Engineering Bacteria Containing Plant Expression Vector pCAMBIA1305.1::p35s-epsps-hmgr-fps-dbr2

[0089] The plant expression vector pCAMBIA1305.1::p35s-epsps-hmgr-fps-dbr2 obtained in Example 1 containing hmgr, fps, dbr2 and epsps genes is transferred into Agrobacterium tumefaciens EHA105 (purchased from Australia CAMBIA, bacterial strain number is Gambar1), and verified by PCR. The results showed that the plant expression vector pCAMBIA1305.1::p35s-epsps-hmgr-fps-dbr2 containing hmgr, fps, dbr2 and epsps genes had been successfully transformed into the Agrobacterium tumefaciens strain.

[0090] 2. Transformation of Artemisia annua with hmgr, fps, dbr2 and epsps genes mediated by Agrobacterium tumefaciens

[0091]2.1. Preculture of explants

[0092] Artemisia annua...

Embodiment 3

[0111] Determination of artemisinin content in transgenic Artemisia annua by HPLC-ELSD

[0112] 1. HPLC-ELSD conditions and system suitability and preparation of standard solutions:

[0113] HPLC (high performance liquid chromatography): adopt WaterAlliance2695 system, chromatographic column is C-18 reverse phase silica gel column (SymmetryShieldTMC18, 5 μ m, 250 * 4.6mm, Waters), mobile phase is methanol: water, the volume ratio of methanol: water is 70 :30, column temperature 30°C, flow rate 1.0mL / min, injection volume 10μL, sensitivity (AUFS=1.0), and theoretical plate number not less than 2000 based on artemisinin peak.

[0114] ELSD (Evaporative Light Scattering Detector): WaterAlliance2420 system was adopted, the drift tube temperature of the evaporative light scattering detector was 40° C., the amplification factor (gain) was 7, and the carrier gas pressure was 5 bar.

[0115] Accurately weigh 2.0 mg of artemisinin standard (Sigma Company) and dissolve it completely in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transgenic sweet wormwood plant in which exogenous target genes consisting of hmgr, fps, dbr2 and epsps are introduced, and a cultivation method thereof. The cultivation method comprises the following steps: (1) constructing a plant expression vector containing the hmgr, fps, dbr2 and epsps genes; 2) transforming the obtained plant expression vector into Agrobacterium tumefaciems; 3) transforming the obtained Agrobacterium tumefaciems containing the hmgr, fps, dbr2 and epsps genes into sweet wormwood and detecting obtained transgenic sweet wormwood plants; 4) measuring the content of artemisinin in the transgenic sweet wormwood plants; and 5) screening transgenic sweet wormwood plants with glyphosate resistance by using glyphosate. The method capable of stably improving the artemisinin content and glyphosate resistance of sweet wormwood is established by using a metabolic engineering strategy of cotransformation of the hmgr, fps, dbr2 and epsps genes; the transgenic sweet wormwood plant capable with high yield of artemisinin is obtained; and an ideal method and material are provided for large-scale production of artemisinin.

Description

technical field [0001] The invention belongs to the field of metabolic engineering, and relates to a transgenic Artemisia annua plant and a cultivation method thereof, in particular to an Artemisia annua plant with high yield of artemisinin and glyphosate resistance and a cultivation method thereof. Background technique [0002] Artemisia annua L. is an annual herb belonging to the family Asteraceae. Artemisinin (artemisinin) is a sesquiterpene lactone compound containing a peroxide bridge structure isolated from its aerial part. It is currently the most effective drug for treating malaria in the world, especially for cerebral malaria and anti-malaria Chloroquine malaria has the characteristics of quick action and low toxicity. In September 2011, Chinese scientist Tu Youyou won the Lasker Award and the "Outstanding Achievement Award in Life Sciences" of GlaxoSmithKline China R&D Center for her discovery of artemisinin. In October 2015, Tu Youyou won the Nobel Prize in Phys...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84C12N1/21A01H5/00G01N30/02
Inventor 唐克轩刘萌石璞付雪晴沈乾孙小芬王国丰
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com