Transgenic sweet wormwood plant and cultivation method thereof
A transgenic, Artemisia annua technology, applied in the field of metabolic engineering, can solve the problem of difficult to solve the problem of chemical weeding in Artemisia annua fields, and achieve the effect of improving glyphosate resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Construction of plant expression vectors containing hmgr, fps, dbr2 and epsps genes
[0037] The map of the plasmid vector pCAMBIA1305.1::p35s-epsps-hmgr-fps-dbr2 that needs to be constructed is as follows figure 1 shown.
[0038] 1. Use PCR to clone hmgr, fps and dbr2 genes from the Artemisia annua genome, and continue to amplify the genes from the artificially synthesized epsps gene fragment.
[0039] PCR primers are:
[0040] hmgr-FP:ATGGATCTCCGTCGTAAACTGCC;
[0041] hmgr-RP: TCACACCTTTGACGCAATTGCTGAC;
[0042] fps-FP: ATGAGTAGTACCGATCTGAAATC;
[0043] fps-RP: CTACTTTTGCCTCTTGTAAATTTTACCC;
[0044] dbr2-FP: ATGTCTGAAAAACCAACCTTGTTTTCTGCC;
[0045] dbr2-RP: CTAGAGGAGTGACCCTTTGTCAAGAG;
[0046] epsps-FP: ATGGCGCAAGTTAGCAGAATCTGC;
[0047] epsps-RP: TTAGTCGTTAAGGTGAACTCCTAG.
[0048] The PCR conditions are:
[0049] hmgr: Pre-denaturation at 95°C for 5min; denaturation at 94°C for 30s; annealing at 55°C for 30s; extension at 68°C for 2min, 35 cycles; extension a...
Embodiment 2
[0087] Agrobacterium tumefaciens mediated hmgr, fps, dbr2 and epsps gene genetic transformation of Artemisia annua to obtain transgenic Artemisia annua plants
[0088] 1. Acquisition of Agrobacterium tumefaciens Engineering Bacteria Containing Plant Expression Vector pCAMBIA1305.1::p35s-epsps-hmgr-fps-dbr2
[0089] The plant expression vector pCAMBIA1305.1::p35s-epsps-hmgr-fps-dbr2 obtained in Example 1 containing hmgr, fps, dbr2 and epsps genes is transferred into Agrobacterium tumefaciens EHA105 (purchased from Australia CAMBIA, bacterial strain number is Gambar1), and verified by PCR. The results showed that the plant expression vector pCAMBIA1305.1::p35s-epsps-hmgr-fps-dbr2 containing hmgr, fps, dbr2 and epsps genes had been successfully transformed into the Agrobacterium tumefaciens strain.
[0090] 2. Transformation of Artemisia annua with hmgr, fps, dbr2 and epsps genes mediated by Agrobacterium tumefaciens
[0091]2.1. Preculture of explants
[0092] Artemisia annua...
Embodiment 3
[0111] Determination of artemisinin content in transgenic Artemisia annua by HPLC-ELSD
[0112] 1. HPLC-ELSD conditions and system suitability and preparation of standard solutions:
[0113] HPLC (high performance liquid chromatography): adopt WaterAlliance2695 system, chromatographic column is C-18 reverse phase silica gel column (SymmetryShieldTMC18, 5 μ m, 250 * 4.6mm, Waters), mobile phase is methanol: water, the volume ratio of methanol: water is 70 :30, column temperature 30°C, flow rate 1.0mL / min, injection volume 10μL, sensitivity (AUFS=1.0), and theoretical plate number not less than 2000 based on artemisinin peak.
[0114] ELSD (Evaporative Light Scattering Detector): WaterAlliance2420 system was adopted, the drift tube temperature of the evaporative light scattering detector was 40° C., the amplification factor (gain) was 7, and the carrier gas pressure was 5 bar.
[0115] Accurately weigh 2.0 mg of artemisinin standard (Sigma Company) and dissolve it completely in...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com