DNA (deoxyribonucleic acid) molecular markers for identifying early bolting of angelica sinensis and application of DNA molecular markers

A technology of DNA molecule and Angelica sinensis, applied in the field of identification of early shoots of Angelica sinensis, can solve the problems affecting the yield and quality of Angelica sinensis, and the identification method of early shoots of Angelica sinensis has not been reported, and achieves good stability and good repeatability

Active Publication Date: 2016-03-30
NANJING UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The early sprouting of Angelica sinensis affects the yield and quality of Angelica sinensis, so it is of great significance to breed excellent varieties of Angelica sinensis, but there is no report on the identification method of Angelica sinensis early sprouting

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA (deoxyribonucleic acid) molecular markers for identifying early bolting of angelica sinensis and application of DNA molecular markers
  • DNA (deoxyribonucleic acid) molecular markers for identifying early bolting of angelica sinensis and application of DNA molecular markers
  • DNA (deoxyribonucleic acid) molecular markers for identifying early bolting of angelica sinensis and application of DNA molecular markers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] DNA molecular marker sequence screening method of Angelica early sprouts:

[0025] 1. Total DNA Extraction from Angelica Genome

[0026] Plant genomic DNA was extracted using the modified CTAB method. Weigh 1 g of Angelica sinensis leaves, grind them into powder with liquid nitrogen, collect the powder in a centrifuge tube, add 4 mL of CTAB extract preheated to 65 °C, and incubate at 65 °C for 1 h. Add an equal volume of chloroform / isoamyl alcohol (24:1) for extraction, invert to mix well, centrifuge at 5500rpm / min for 10min, take the supernatant, and repeat the extraction 2-3 times. Aspirate the supernatant and add 2 / 3 volume of pre-cooled isopropanol, and let stand at -20°C for 2h. Centrifuge at 7500g for 10min, dissolve the precipitate with 400μLTE, add 4μL of pre-boiled RNaseA, and incubate at 37°C for 30min. Then extract with an equal volume of chloroform / isoamyl alcohol (24:1) for 1-2 times, take the supernatant and add an equal volume of isopropanol to precipi...

Embodiment 2

[0092] Primers were designed for the molecular marker ZT-2, and PCR amplification was performed using Angelica sinensis DNA as a template. The primer sequence is, Primer-F:

[0093] CCGTAGGCTGATCCTTTCCCT, Primer-R: CCATGAACCAAGTGCCTTCAC. The PCR amplification reaction was carried out with the genome DNA of early sprouts and normal angelica as templates. Reaction conditions, denaturation at 94°C for 3min; denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 1min (40 rings). Electrophoresis was performed on the PCR products, and the labeling rate of Angelica zaponicae was 75%. Example 3

Embodiment 3

[0094] Primers were designed for the molecular marker ZT-3, and PCR amplification was performed using Angelica sinensis DNA as a template. The primer sequence is, Primer-F:

[0095] GAGTACCTAGGCGGAGTACA, Primer-R:ACACCCAATAACCATCACCC. The PCR amplification reaction was carried out with the genome DNA of early sprouts and normal angelica as templates. Reaction conditions, denaturation at 94°C for 3min; denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 1min (40 rings). Electrophoresis was performed on the PCR products, and the labeling rate of Angelica zaponicae was 70%. Example 4

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses DNA (deoxyribonucleic acid) molecular markers for identifying early bolting of angelica sinensis and application of the DNA molecular markers. According to the invention, the difference of early bolting angelica sinensis and normal angelica sinensis in genome level is studied through an amplified fragment length polymorphic analysis technology, specific molecular marker fragments of the early bolting angelica sinensis are obtained, the sequences of differential fragments are analyzed through a PCR (Polymerase Chain Reaction) technology, and three DNA molecular markers are obtained. According to the invention, AFLP (Amplified Fragment Length Polymorphism) is adopted to screen the molecular markers of the angelica sinensis related to the early bolting, establishment and optimization are performed through a large number of experiments, an AFLP reaction and silver staining reaction system applicable to angelica sinensis seeds is obtained, a clear DNA fingerprint is obtained, and molecular linkage markers of the early bolting character of the angelica sinensis are obtained by screening. Through the invention, the obtained DNA molecular markers by optimization are good in stability and repeatability, can be applied to germplasm identification of the early bolting angelica sinensis, and has significance for breeding an angelica sinensis variety which can resist early bolting.

Description

technical field [0001] The invention relates to a method for identifying early shoots of angelica, in particular to a DNA molecular marker sequence for identifying early shoots of angelica and its specific application. Background technique [0002] High sensitivity, high specificity, simple and rapid detection of nucleic acid sequences are of great significance for molecular markers of medicinal plant-specific traits and germplasm breeding of medicinal plants. In the past, more accurate and sensitive detection methods in this respect include detection of physiological and biochemical indicators, microscopic detection, etc. These methods require complex operations and special equipment. In 1993, Dr.KaryB.Mullis of PE Company invented the polymerase chain reaction (PolymeraseChainReaction), referred to as PCR. Subsequently, PCR technology was widely used in biological research and clinical treatment, and the detection of DNA entered a new era. [0003] The basic principle of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor段金廒于光
OwnerNANJING UNIVERSITY OF TRADITIONAL CHINESE MEDICINE