Supercharge Your Innovation With Domain-Expert AI Agents!

Lamp detection primer set, lamp detection kit and detection method of transgenic herbicide-resistant soybean bps-cv127-9

A detection kit and anti-herbicide technology, applied in the field of molecular biology, can solve problems such as difficult on-site detection, low sensitivity, and affecting detection accuracy, and achieve the effect of mild conditions and easy operation

Active Publication Date: 2018-12-18
SHANGHAI IGENETEC DIAGNOSTICS CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] 1) Protein-based detection, now the most widely used detection methods are enzyme-linked immunosorbent assay (ELISA) and Western blot detection methods, which require high-quality, high-specificity antibodies, otherwise it will affect the accuracy of detection, low sensitivity;
[0007] 2) DNA-based detection is mainly for the detection of exogenously inserted genes in transgenic crops, mainly including molecular hybridization technology, PCR detection technology and chip detection technology, among which PCR detection method is the most important and most accurate detection of genetically modified crops method, but the reaction system and operation process of this method are relatively complicated, requiring professionals; a specific PCR instrument is required, and the amplification time is 2 to 3 hours. Strong toxicity, and difficult to implement on-site detection
[0009] Loop-Mediated Isothermal Amplification technology (Loop-Mediated Isothermal Amplification, hereinafter referred to as LAMP method) is a gene amplification technology developed by Notomi and Okayama around 2000. It has the advantages of fast and simple, accurate operation, easy popularization, safety and reliability. At present, there is no kit that applies constant temperature amplification visual detection technology and constant temperature real-time fluorescence technology to the rapid detection of transgenic herbicide-resistant soybean BPS-CV127-9 and its derivatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lamp detection primer set, lamp detection kit and detection method of transgenic herbicide-resistant soybean bps-cv127-9
  • Lamp detection primer set, lamp detection kit and detection method of transgenic herbicide-resistant soybean bps-cv127-9
  • Lamp detection primer set, lamp detection kit and detection method of transgenic herbicide-resistant soybean bps-cv127-9

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1 Kit and detection method containing chromogenic agent

[0068] A LAMP detection kit, including primer solution, reaction solution, DNA polymerase, control and chromogenic reagent:

[0069] (1) Primer solution: Contains 50 μM outer primer 1, 50 μM outer primer 2, 50 μM inner primer 1, 50 μM inner primer 2, the four primers are:

[0070] Outer primer 1: TGTTTGGAAGCTTGAAACG (SEQ ID No: 1);

[0071] Outer primer 2: GATCGGGTTTGTGACAGC (SEQ ID No: 2);

[0072] Internal primer 1: CGGAATTGGTAATCGAAATTAGGGTGGGCAAACTAGTCTCGTAA (SEQ ID No: 3);

[0073] Inner primer 2: AAGAAGTCATGGAAGCCATTGATTCGAGACGAACACTGCTCTTA (SEQ ID No: 4).

[0074] (2) Reaction solution: containing 12mM dNTP, 10×Isothermal Amplification reaction buffer, 150mMMgSO 4 Aqueous solution, the volume ratio of the three is 8:5:2;

[0075] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0076] (4) Control: Escherichia coli plasmid DNA containing the target gene, and the negative c...

Embodiment 2

[0099] Embodiment 2 The kit and detection method thereof without chromogenic agent

[0100] The kit is the same as that in Example 1 except that it lacks the chromogenic agent and fluorescent indicator in Example 1.

[0101] Use the above kit to detect the sample to be tested in the following way:

[0102] 1) DNA extraction of the sample to be tested: the DNA of the sample to be tested is extracted and purified by the CTAB method;

[0103] 2) Constant temperature detection reaction: prepare a reaction system in a 200ul PCR tube: 1.8μl primer solution, 15.2μl reaction solution, 1μl DNA polymerase, 1-6μl DNA to be tested, make up to 25μl with DNase / RNase-Free Distilled Water; set For the positive control reaction, use the DNA of transgenic herbicide-resistant soybean BPS-CV127-9 or E. coli plasmid DNA containing the target gene to replace the DNA to be tested. When setting a negative control reaction, use the reaction mixture without the target gene to replace the sample to be ...

Embodiment 3

[0107] Embodiment 3 PCR reaction and the comparison of detection method sensitivity of the present invention

[0108] Prepare the LAMP detection kit of transgenic herbicide-resistant soybean BPS-CV127-9 according to the following formula:

[0109] (1) Primer solution: Contains 50 μM outer primer 1, 50 μM outer primer 2, 50 μM inner primer 1, 50 μM inner primer 2, the four primers are:

[0110] Outer primer 1: TGTTTGGAAGCTTGAAACG (SEQ ID No: 1);

[0111] Outer primer 2: GATCGGGTTTGTGACAGC (SEQ ID No: 2);

[0112] Internal primer 1: CGGAATTGGTAATCGAAATTAGGGTGGGCAAACTAGTCTCGTAA (SEQ ID No: 3);

[0113] Inner primer 2: AAGAAGTCATGGAAGCCATTGATTCGAGACGAACACTGCTCTTA (SEQ ID No: 4).

[0114] (2) Reaction solution: containing 12mM dNTP, 10×Isothermal Amplification reaction buffer, 150mMMgSO 4 Aqueous solution, the volume ratio of the three is 8:5:2;

[0115] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0116] (4) Control: the positive control is E. coli p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a detection method, an LAMP (loop-mediated isothermal amplification) detection kit and an LAMP detection primer group of transgenic herbicide-resistant soybean BPS-CV127-9. The LAMP detection primer group comprises four specific primers; the LAMP detection kit comprises primer liquid, reaction liquid, DNA (deoxyribonucleic acid) polymerase and contrasts and can further comprises a color developing agent or a fluorescence indicating agent. The detection method includes that a sample DNA template is amplified at the temperature of 60-65 DEG C by extraction of DNA of a to-be-detected sample and adoption of the four specific primers and the DNA polymerase with strand displacement activity. Amplification efficiency can reach 109-1010 copies in short time, and whether the to-be-detected sample contains the transgenic herbicide-resistant soybean BPS-CV127-9 and derived varieties thereof or not is determined by observation of turbidity changes of precipitation in a reaction tube, addition of the color developing agent for observation of color changes in the reaction tube and adoption of a real-time fluorescence detector for observation. The detection method, the LAMP detection kit and the LAMP detection primer group of the transgenic herbicide-resistant soybean BPS-CV127-9 have the advantages of quickness, high efficiency, simplicity and convenience in operation and identification, high specificity, high sensitivity, suitableness for field detection and the like and is suitable for popularization and application.

Description

technical field [0001] The invention relates to the technical field of molecular biology, and belongs to a detection method for transgenic crops, in particular to a LAMP detection primer set, a LAMP detection kit and a detection method for transgenic herbicide-resistant soybean BPS-CV127-9 and derivatives thereof. Background technique [0002] Soybean is an important oil crop, and its output ranks first among all edible oil crops in the world. Soybean is also a high-quality and high-protein plant resource, containing 8 kinds of amino acids necessary for human body. The origin of soybeans is China, and the main origins are the United States, Brazil, Argentina and China. Domestically produced soybeans cannot meet market demand, and the quantity of imported soybeans has increased accordingly. [0003] BPS-CV127-9 soybean is developed by BASF Plant Science Company. It is a soybean crop resistant to imidazolinone agricultural herbicides. It contains the gene csr1-2 of the large...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6844C12Q1/6895C12N15/11
CPCC12Q1/6844C12Q1/6895C12Q2600/13C12Q2531/119
Inventor 方雪恩王欣珍孔凡树陈旭徐凌佳孔继烈
Owner SHANGHAI IGENETEC DIAGNOSTICS CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More