Use of human gtpbp4 gene and related medicines
A gene and application technology, applied in the field of application of human GTPBP4 gene and related medicines, can solve the problem of few reports on GTPBP4
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0078] Example 1 Preparation of RNAi lentivirus against human GTPBP4 gene
[0079] 1. Screening for effective siRNA targets against the human GTPBP4 gene
[0080] Retrieve GTPBP4 (NM_012341) gene information from Genbank; design effective siRNA targets for GTPBP4 gene. Table 1 lists 5 effective siRNA target sequences for the GTPBP4 gene.
[0081] Table 1 siRNA target sequence targeting human GTPBP4 gene
[0082] SEQ ID NO TargetSeq 1 GCGTAGTCTTGGTGTTGACAT 2 GCTGGAGAGTATGACAGTGTA 3 GCTCATCGAGTGGAAACCAAA 4 GCGTCAGCATTTATCCCGTTT 5 CCAACCGTTATTCATAAACAT
[0083] 2. Preparation of lentiviral vector
[0084] Aim at the siRNA target (taking SEQ ID NO: 1 as an example) to synthesize a double-stranded DNA Oligo sequence (Table 2) with Age I and EcoR I restriction endonucleases at both ends; use Age I and EcoR I restriction enzyme Act on the pGCSIL-GFP carrier (provided by Shanghai Jikai Gene Chemical Technology Co., Ltd., figure 1 ), t...
Embodiment 2
[0105] Example 2 Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of GTPBP4 gene
[0106] Colon cancer RKO cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, RKO: 10) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 4 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV operation manual of Promega Company, the RNA was reverse-transcribed to obtain cDNA (reverse transcription reaction system is shown in Table 7, 42 ° C for 1 h) and then in a 70 ° C water bath for 10 min to inactivate the reverse transcriptase.
[0...
Embodiment 3
[0113] Example 3 Detection of proliferation ability of tumor cells infected with GTPBP4-siRNA lentivirus
[0114] Colon cancer RKO cells in logarithmic growth phase were trypsinized to make cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, RKO: 10), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 4 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the Cellomics ArrayScan VTI high-content screening analyzer (Th...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com