Inducible expression, purification and activity identification method of restructured lunasin polypeptide in pichia pastoris

A technology of inducing expression and Pichia pastoris, applied in the field of genetic engineering, can solve the problems of low yield, cumbersome Lunasin steps, restricting research and application, etc., and achieves the effects of high yield, simple discrete purification steps, and low cost.

Inactive Publication Date: 2016-06-08
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in natural crops, the content of Lunasin is low, and the steps of isolating and purifying Lunasin from it are cumbersome and the yield is low, which makes most studies on Lunasin activity use expensive synthetic Lunasin as raw material, which limits its further research and application.
[0003] At present, there is no domestic report on how to use genetic engineering methods to clone and transfer the Lunasin gene fragment into Pichia pastoris, and produce highly active eukaryotic expression Lunasin through induced expression and purification steps

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Inducible expression, purification and activity identification method of restructured lunasin polypeptide in pichia pastoris
  • Inducible expression, purification and activity identification method of restructured lunasin polypeptide in pichia pastoris
  • Inducible expression, purification and activity identification method of restructured lunasin polypeptide in pichia pastoris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] (1) Construction of recombinant expression plasmid

[0050] The secretory Pichia pastoris expression plasmid pPIC9K (commercially available) was selected as the target gene expression vector, and the Lunasin sequence with EcoRI and NotI restriction sites was designed as GAATTCTCCAAATGGCAGCACCAGCAAGACAGCTGCCGCAAGCAGCTCCAGGGGGTGAACCTCACGCCTTGCGAGAAGCACATCATGGAGAAGATCCAAGGCCGCGGCGATGACGATGATGATGATGACGACGACGACGCGGCCCTACTACTGCTGCTGCGCCGG.

[0051] Design specific amplification primers: upstream primer: 5'-GGAATTCTCCAAATGGCAGCAC-3'; downstream primer: 5'-TTGGCCGCGTCGTCGTCATCATC-3'. PCR amplification was performed to obtain the target gene fragment. PCR conditions were: 94°C for 5 min, 94°C for 30s, 55°C for 30s, 72°C for 60s, 35 cycles, and 72°C for 10 min.

[0052] Using the restriction enzymes EcoRI and NotI double digestion, the plasmid pPIC9K double-digested with the same restriction enzymes EcoRI and NotI was ligated with the PCR product after digestion with T4 DNA liga...

Embodiment 2

[0070] Example 2 Identification of Physiological Activity of Recombinant Lunasin Polypeptide

[0071] 3T3-L1 preadipocytes were seeded in a 12-well plate at a density of 10,000 cells / mL, and after growth and fusion, they were cultured for another 48 hours, and induction solution I was added. The induction solution I contained 10% FBS, 1% double antibody, 10 μg / ml insulin, 0.5mM IBMX (3-isobutyl-1-methylxanthine) and DMEM medium of 0.1 μM DEX (dexamethasone); after culturing for 48h, it was replaced with induction solution II, which was composed of Cultured in DMEM medium of 5 μg / ml insulin; after culturing for 48 hours, it was replaced with DMEM medium containing 50 μg / ml (recombinant lunasin group-50) or 100 μg / ml (recombinant lunasin group-100) recombinant Lunasin polypeptide, and added with 5 μg / ml Rosiglitazone was used as a positive control group, and no lunasin was added as a blank control group. After culturing for 48 hours, the mice were fixed in 10% formaldehyde buff...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an inducible expression, purification and activity identification method of restructured lunasin polypeptide in pichia pastoris. The inducible expression and purification method includes 1) establishing the restructured expression plasmid: designing Lunasin sequence with EcoR I and Not I restriction enzyme sites, and designing specificity ampflification primer for PCR (polymerase chain reaction) amplification to obtain target gene segments; 2) screening high-resistance restructured gene engineering strains; 3) fermenting the restructured lunansin polypeptide; 4) separating and purifying the restructured lunansin polypeptide: obtaining the restructured lunasin polypeptide with purity at 93%. The pichia pastoris is firstly used to prepare lunasin polypeptide, and batch production of the lunasin polypeptide can be realized through the gene engineering method. The lunasin polypeptide expressed by the pichia pastoris is low in cost, and high in production, and separation and purification steps are simple.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for preparing lunasin polypeptide in Pichia pastoris expression system, in particular to a method for inducing expression, purification and physiological activity identification of recombinant lunasin polypeptide in Pichia pastoris. Background technique [0002] Lunasin is a novel polypeptide containing 43 amino acids, which was isolated and identified from soybean seeds for the first time. Studies have shown that lunasin has many special physiological activities, including anti-cancer and anti-inflammatory. In addition, patent 201510224932.9 discloses that lunasin can inhibit the differentiation of mouse preadipocytes (3T3-L1) through the PPAR pathway and has potential weight loss activity. However, in natural crops, the content of Lunasin is low, the separation and purification of Lunasin from it is cumbersome, and the yield is low, which makes most of the studies o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12N15/66C07K14/415C07K1/36C07K1/34C07K1/18C12Q1/02C12R1/84
CPCC07K14/415C12N15/66C12N15/815C12N2503/00C12N2800/102G01N33/5038
Inventor任贵兴朱莹莹顿宝庆么杨王智
OwnerINST OF CROP SCI CHINESE ACAD OF AGRI SCI