A kind of ehec O157: H7 recombinant Lactobacillus acidophilus vector vaccine and its preparation method and application
A technology of EHECO157, Lactobacillus acidophilus, applied in the field of genetic engineering, can solve the problems such as no Lactobacillus acidophilus, and achieve the effect of good immunogenicity and immune protection effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1: the preparation of EHEC O157:H7 recombinant Lactobacillus acidophilus live vector vaccine strain
[0046] like figure 1 Shown, the concrete method of the present invention is:
[0047] 1. Design and synthesis of primers
[0048] Search the EspA gene sequence (KJ549678.1) and Tir M gene sequence (NC_002655.2) from GenBank, introduce the Pst I restriction site at the 5′ end of the EspA upstream primer, remove the stop codon TAA with the downstream primer, and introduce the linker (ggaggcggaagtggaggaggtagc), The primers were designed as follows: EspA-P1: 5′-AAAACTGCAGGATGGATACATCAAATGCA (SEQ ID No.2), EspA-P2: 5′-GCTACCTCCTCCACTTCCGCCTCCTTTACCAAGGGATATTGCTG (SEQ ID No.3); Tir M upstream primer was introduced into the linker, and the downstream primer was introduced into the restriction site Hind III, Tir M-P1:5′-GGAGGCGGAAGTGGAGGAGGTAGC AGCCCAACCACGACCGAC (SEQ ID No.4), Tir M-P2:5′-CCCAAGCTTTTAGGCTTGCTGTTT GGCCTCTT (SEQ ID No.5), primers were synthesized by...
Embodiment 2
[0081] sExample 2: Recombinant Lactobacillus acidophilus expressing EHEC O157:H7EspA-Tir M protein has immune protection to mice infected with O157:H7
[0082] 1. Inoculate the recombinant Lactobacillus acidophilus in MRS broth containing 0.1ug / ml erythromycin, culture anaerobically at 37°C until the logarithmic growth phase, collect the bacterial sediment, and adjust the bacterial density to 10 10 CFU / ml immunized mice.
[0083] 2. Study on the immunogenicity of recombinant Lactobacillus acidophilus: select 4-5 week-old SPF grade BALB / c mice, and inject 0.1ml 10 into each group with 15 mice 10 CFU / ml of recombinant Lactobacillus acidophilus, and set PBS negative control at the same time, the immunization program is: 0~3d, 7~10d, 21~24d.
[0084] 2.1 Before each immunization and 10 days after the last immunization, the blood was collected by docking the tail, and after standing at room temperature for 2 hours, the serum was collected by centrifugation (1:50). The specific IgG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


