Infectious hematopoietic necrosis (IHN) nucleic acid vaccines for Chinese rainbow trout and application thereof

A technology of hematopoietic organ necrosis and nucleic acid vaccine, applied in the field of genetic engineering, can solve the problem of not having the same protection

Active Publication Date: 2016-08-03
HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the glycoprotein homology among genotypes of IHNV is high, studies have shown that different genotypes of IHNV nucleic acid vaccines have different degrees of cross-protection. Tianhou can still block the attack of IHNV strains of other genotypes very well, while rainbow trout immunized with U genotype cannot resist the attack of IHNV strains of M genotype very well after 28 days after immunization. High nucleotide and amino acid homology, nucleic acid vaccines constructed against different genotypes of IHNV strains may not have the same protective effect on other genotypes of viruses (Penaranda, Lapatra, Kurath, 2011)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Infectious hematopoietic necrosis (IHN) nucleic acid vaccines for Chinese rainbow trout and application thereof
  • Infectious hematopoietic necrosis (IHN) nucleic acid vaccines for Chinese rainbow trout and application thereof
  • Infectious hematopoietic necrosis (IHN) nucleic acid vaccines for Chinese rainbow trout and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Primer Design and Synthesis

[0025] According to the comparison of multiple gene sequences of IHNV glycoprotein (glycoprotein, G) included in GenBank, the specific conserved segment of the surface glycoprotein G gene was selected, and the glycoprotein used to amplify J genotype IHNV was designed using Primeprimer5.0 software The sequence of G gene is shown in Table 1, and the primers were synthesized by Harbin Boshi Biological Company.

[0026]Table 1 is used to amplify the primer sequence of the IHNV glycoprotein G gene of J genotype

[0027]

[0028] The amplified sequence is the Chinese rainbow trout infectious hematopoietic organ necrosis protective antigen gene, as shown in SEQIDNo.3:

[0029] TTGAGACCGAACGCAACTCGCAGAGACCCACCGAAACA

[0030] ATGGACGCCATGATCACCACTCCGCTCATTCTCATTCTAATCACCTGTGGAGCAAACAGCCAAACAGTCCCCCCCGACACCGCAAGCGAATCAGACCAACCCACCTGGTCAAACCCGCTCTTCACCTACCCCGAGGGATGCACTCTGGACAAACTCTCCAAGGTCAATGCTTCTCAACTGAGATGCCCAAGGATCTTCGATGATGAGAACAG...

Embodiment 2

[0032] Amplification and RNA preparation of embodiment 2 virus

[0033] Virus isolate IHNV (HLJ-15, LN-15, GS-15, XJ-15, YN-15) virus suspension was diluted to 10 with cell maintenance fluid (MEM medium containing 2% FBS). -5 Take 1ml of the virus suspension and inoculate it on confluent monolayer EPC cells, incubate at 15°C for 1h, discard the virus suspension, add 5mL of cell maintenance solution to the cell culture flask, and incubate at 15°C. When more than 80% of the cells appear cytopathic effect (cytopathic effect, CPE), the cell culture medium (ie virus suspension) is collected. Take 150 μL of the virus suspension in an RNase-free centrifuge tube. Centrifuge at 12000g for 5min to remove the precipitate. Viral genomic RNA was extracted according to the instructions of SVTotalRNAIsolationSystem. The extracted RNA was aliquoted and stored at -80°C for later use.

Embodiment 3

[0034] The amplification of embodiment 3 glycoprotein genes

[0035] According to the instructions of the one-step RT-PCR kit, the G genes of different isolates were respectively amplified with GflankF1 / F2 as primers. RT-PCR amplification program: pre-reaction at 50°C for 30 minutes, pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 1 minute, annealing at 50°C for 1 minute, extension at 72°C for 90 seconds, cycle number 30, final extension at 72°C for 10 minutes. The RT-PCR products were gel-recovered after 1% agarose gel electrophoresis, and the recovered products were ligated with the pMD19-Tsimple vector, and the ligated products were transformed into DH5α competent cells, and single colonies were picked and expanded for culture, and the plasmids were extracted and identified by PCR. The correct plasmid was sequenced.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides infectious hematopoietic necrosis (IHN) nucleic acid vaccines for Chinese rainbow trout and application thereof. A preparation method of the IHN nucleic acid vaccines for Chinese rainbow trout includes the following steps that firstly, specific primers for amplifying genotype J IHN virus surface glycoprotein genes (Glycoprotein, G) are designed; secondly, IHN virus isolates are cultured with a virus sensitive cell line, and then virus genome RNA is extracted; thirdly, the virus genome RNA obtained in the second step is subjected to one-step RT-PCR amplification with the primers obtained in the first step; fourthly, a recovery product obtained in the third step is connected with a pMD19-T simple vector, a connection product is converted into DH5alpha competent cells, single colonies are picked out, plasmids are extracted for PCR identification after amplified culture, and plasmids identified to be correct are subjected to sequencing; fifthly, IHNV isolate glycoprotein genes identified to be correct in the fourth step are cloned to a eukaryotic expression vector pcDNA3.1 with BamH I and Xho I restriction enzyme cutting sites to establish the nucleic acid vaccines.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a Chinese rainbow trout infectious hematopoietic necrosis nucleic acid vaccine, a preparation method and application thereof. Background technique [0002] Infectious hematopoietic necrosis (IHN) is a common acute viral infectious disease that harms salmon and trout caused by infectious hematopoietic necrosis virus (IHNV). Since the first outbreak in the United States in the 1950s, IHNV has spread to more than ten countries including Europe, Australia, and Asia. According to different strains of virus, environmental factors, and age of fish, IHNV can cause up to 100% mortality of salmon and trout, which has caused huge economic losses to the salmon and trout farming industry in the world. [0003] IHNV belongs to the Rhabdoviridae family (Rhabdoviridae), a single-strand, negative-strand, RNA virus of the genus Novirhabdovirus, with a total genome length of about 11kb, includin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/205A61K48/00C12N15/47C12N15/11C12N15/85A61P31/14
CPCA61K39/12A61K2039/53A61K2039/54A61K2039/552C07K14/005C12N15/85C12N2760/20022C12N2760/20034C12N2800/106
Inventor 徐黎明赵景壮卢彤岩刘淼曹永生
Owner HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products