Infectious hematopoietic necrosis (IHN) nucleic acid vaccines for Chinese rainbow trout and application thereof
A technology of hematopoietic organ necrosis and nucleic acid vaccine, applied in the field of genetic engineering, can solve the problem of not having the same protection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Primer Design and Synthesis
[0025] According to the comparison of multiple gene sequences of IHNV glycoprotein (glycoprotein, G) included in GenBank, the specific conserved segment of the surface glycoprotein G gene was selected, and the glycoprotein used to amplify J genotype IHNV was designed using Primeprimer5.0 software The sequence of G gene is shown in Table 1, and the primers were synthesized by Harbin Boshi Biological Company.
[0026]Table 1 is used to amplify the primer sequence of the IHNV glycoprotein G gene of J genotype
[0027]
[0028] The amplified sequence is the Chinese rainbow trout infectious hematopoietic organ necrosis protective antigen gene, as shown in SEQIDNo.3:
[0029] TTGAGACCGAACGCAACTCGCAGAGACCCACCGAAACA
[0030] ATGGACGCCATGATCACCACTCCGCTCATTCTCATTCTAATCACCTGTGGAGCAAACAGCCAAACAGTCCCCCCCGACACCGCAAGCGAATCAGACCAACCCACCTGGTCAAACCCGCTCTTCACCTACCCCGAGGGATGCACTCTGGACAAACTCTCCAAGGTCAATGCTTCTCAACTGAGATGCCCAAGGATCTTCGATGATGAGAACAG...
Embodiment 2
[0032] Amplification and RNA preparation of embodiment 2 virus
[0033] Virus isolate IHNV (HLJ-15, LN-15, GS-15, XJ-15, YN-15) virus suspension was diluted to 10 with cell maintenance fluid (MEM medium containing 2% FBS). -5 Take 1ml of the virus suspension and inoculate it on confluent monolayer EPC cells, incubate at 15°C for 1h, discard the virus suspension, add 5mL of cell maintenance solution to the cell culture flask, and incubate at 15°C. When more than 80% of the cells appear cytopathic effect (cytopathic effect, CPE), the cell culture medium (ie virus suspension) is collected. Take 150 μL of the virus suspension in an RNase-free centrifuge tube. Centrifuge at 12000g for 5min to remove the precipitate. Viral genomic RNA was extracted according to the instructions of SVTotalRNAIsolationSystem. The extracted RNA was aliquoted and stored at -80°C for later use.
Embodiment 3
[0034] The amplification of embodiment 3 glycoprotein genes
[0035] According to the instructions of the one-step RT-PCR kit, the G genes of different isolates were respectively amplified with GflankF1 / F2 as primers. RT-PCR amplification program: pre-reaction at 50°C for 30 minutes, pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 1 minute, annealing at 50°C for 1 minute, extension at 72°C for 90 seconds, cycle number 30, final extension at 72°C for 10 minutes. The RT-PCR products were gel-recovered after 1% agarose gel electrophoresis, and the recovered products were ligated with the pMD19-Tsimple vector, and the ligated products were transformed into DH5α competent cells, and single colonies were picked and expanded for culture, and the plasmids were extracted and identified by PCR. The correct plasmid was sequenced.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com