Unlock instant, AI-driven research and patent intelligence for your innovation.

Combination and application of lamp primers for detection of 4 ophthalmic infection viruses

A primer combination and primer set technology, applied in microorganism-based methods, microorganisms, recombinant DNA technology, etc., can solve the problems of long PCR detection time, application limitations, and high false positive rate.

Active Publication Date: 2019-12-13
智德科技(无锡)有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, PCR has the disadvantages of long detection time, easy contamination, and high false positive rate, which limits its application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Combination and application of lamp primers for detection of 4 ophthalmic infection viruses
  • Combination and application of lamp primers for detection of 4 ophthalmic infection viruses
  • Combination and application of lamp primers for detection of 4 ophthalmic infection viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0169] Embodiment 1, primer design and preparation

[0170] A large number of sequence analyzes and comparisons were carried out to obtain several primers for identifying herpes simplex virus type I, herpes simplex virus type II, cytomegalovirus and varicella-zoster virus. Preliminary experiments were performed on each primer to compare their sensitivity and specificity, and finally four sets of LAMP primers for identifying HSV-I, HSV-II, varicella-zoster virus and cytomegalovirus were obtained.

[0171] A primer set for identifying herpes simplex virus type I, including 2 outer primers (F3-1, B3-1), 2 inner primers (FIP-1, BIP-1) and 2 loop primers (LF-1, LB-1), each primer sequence is as follows (5'→3'):

[0172] F3-1 (sequence 1 of the sequence listing): TGCGGCTCGTGAAGACC;

[0173] B3-1 (sequence 2 of the sequence listing): TACGGCGACGGTGCGTA;

[0174] FIP-1 (SEQ ID NO: 3 of the SEQUENCE LISTING): TACTTACAGGAGCCCTTGGGACTGGACGGAGATTACACAGCG;

[0175] BIP-1 (SEQ ID NO: 4 o...

Embodiment 2

[0204] Embodiment 2, detection method establishment

[0205] 1. Extract the genomic DNA of the virus to be tested or extract the total DNA of the biological sample to be tested.

[0206] 2. Take the DNA obtained in step 1 as a template, and use the primer set I prepared in Example 1 to perform LAMP amplification.

[0207] Reaction system for LAMP amplification: 1μL 10×ThermoPol Buffer, 1.6μL 5M betaine, 0.1μL 50mg / ml BSA, 0.4μL 100mM MgSO 4 , 0.3 μL 20×EvaGreen, 0.15 μL 100 mM dNTPs, 0.4 μL 8U / ml Bst DNA polymerase large fragment, 1 μL primer mix (F3-1, B3-1, FIP-1, BIP-1, LF-1 and LB-1 mixture), 2ng template DNA, with ddH 2 O to make up to 10 μL. The concentration of each primer in the reaction system is as follows: 0.5 μM F3-1, 0.5 μM MB3-1, 2 μM FIP-1, 2 μM BIP-1, 1 μM LF-1, 1 μM LB-1.

[0208] Reaction program for LAMP amplification: constant temperature at 65°C for 50min. During the reaction process, the fluorescent signal was detected by a fluorescent PCR instrument...

Embodiment 3

[0220] Embodiment 3, reference plasmid construction

[0221] Herpes simplex virus type I reference plasmid: insert the double-stranded DNA molecule shown in sequence 25 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-TEasy Vector vector to obtain the reference plasmid.

[0222] Herpes simplex virus type II reference plasmid: insert the double-stranded DNA molecule shown in sequence 26 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-T Easy Vector vector to obtain the reference plasmid.

[0223] Varicella-zoster virus reference plasmid: insert the double-stranded DNA molecule shown in sequence 27 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-T Easy Vector vector to obtain the reference plasmid.

[0224] Cytomegalovirus reference plasmid: Insert the double-stranded DNA molecule shown in sequence 28 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-T Easy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification) primer combination for detecting four types of eye infected viruses and an application. The primer combination comprises 24 single-stranded DNA molecules shown in sequences from 1 to 24. The invention also discloses the application of the primer combination, and further provides a method for identifying herpes simplex virus type I, herpes simplex virus type II, varicella-zoster viruses or cytomegalo viruses, a method for identifying whether the to-be-detected viruses are the herpes simplex virus type I, the herpes simplex virus type II, the varicella-zoster viruses or the cytomegalo viruses, and a method for identifying whether a to-be-detected sample is infected with the herpes simplex virus type I and / or the herpes simplex virus type II and / or the varicella-zoster viruses and / or the cytomegalo viruses. With the application of LAMP primers and the method, the herpes simplex virus type I, the herpes simplex virus type II, the varicella-zoster viruses and the cytomegalo viruses can be detected rapidly and accurately.

Description

technical field [0001] The invention relates to a combination and application of LAMP primers for detecting four ophthalmic infection viruses. Background technique [0002] Herpes simplex virus (HSV) is the pathogen that causes viral herpes. According to the difference in antigenicity, the virus is divided into herpes simplex virus type I and herpes simplex virus type II. Type I primarily causes infections of the skin, mucous membranes (oral mucosa) and organs (brain) other than the genitals. Type II mainly causes skin and mucous membrane infection in the genital area. More than 50% of healthy people are carriers of this virus. HSV does not produce long-term immunity in the human body. Whenever the body's commensurate force drops, such as fever, gastrointestinal dysfunction, menstruation, pregnancy, focal infection, and motivational changes, the hidden HSV in the body is activated and develops disease, which affects human health. . Corneal infection caused by herpes simp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
CPCC12Q1/6844C12Q1/705C12Q2531/119C12Q2563/107
Inventor 陶勇
Owner 智德科技(无锡)有限公司