Small interfering RNA (ribonucleic acid), short hairpin RNA and recombined carrier for SOX4 gene targets, and application of recombined carrier
A technology of SOX4 and recombinant vectors, applied in genetic engineering technology, biomedicine, and molecular biology, can solve problems such as low transfection efficiency, inability to express siRNA persistently, and short-term inhibition of target gene expression, and achieve anti-tumor application value Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Firstly, for the SOX4 gene, the small interfering RNA sequence is designed according to the principles commonly used in the field, and the corresponding short hairpin RNA sequence is synthesized.
[0034] The sense strand sequence of small interfering RNA is 5'-GCGACAAGAUCCCUUUCAU-3', and the antisense strand sequence is 5'-AUGAAAGGGAUCUUGUCGC-3'.
[0035] The sense strand sequence of short hairpin RNA is 5'-GATCCGCGACAAGATCCCTTTCATTTCAAGAGAAT
[0036] GAAAGGGATCTTGTCGCTGA-3';
[0037] The sense strand sequence is 5'-AGCTTCAGCGACAAGATCCCTTTTCATTCTCTTGAAATGAAAGGGA
[0038] TCTTGTCGCG-3'.
[0039] The region targeting SOX4 is: 5'-GCGACAAGATCCTTTCAT-3'.
[0040]In the sense strand, GCGACAAGATCCCTTTCATTTCAAGAGAATGAAAGGGATCTTGTCGC constitutes the stem-loop structure of RNA formed after transcription, and TTCAAGAGA forms a loop.
[0041] In the antisense strand, GCGACAAGATCCTTTCATTCTCTTGAAATGAAAGGGATCTTGTCGC constitutes the stem-loop structure of RNA formed after transcri...
Embodiment 2
[0044] Construction of interfering RNA recombinant vector targeting SOX4
[0045] Synthetic DNA sequence: the sense strand and the antisense strand were dissolved in double distilled water, respectively, at a concentration of 1 mg / mL. Take 2 μL each, add double-distilled water to 50 μL, mix evenly, place in a 95°C water bath for 5 minutes, and cool naturally to room temperature. The resulting annealed double-stranded DNA can be stored in a -20°C refrigerator for future use.
[0046] The map of pSilencer 4.1-CMV neo plasmid is as follows figure 1 As shown, the interfering RNA DNA sequence is inserted between HindIII (463) and BamHI (516).
[0047] Mix 1 μg of pSilencer empty vector plasmid, 1 μL (10 units) of each endonuclease HindIII and BamHI, 2 μL of 10X digestion buffer and an appropriate volume of double distilled water to make the total volume reach 20 μL, and react at 37°C for 30 minutes. After the reaction, add 2 μL of 10X DNA loading buffer to 1% agarose gel electro...
Embodiment 3
[0050] Expression of SOX4 in Esophageal Squamous Cell Carcinoma Cells
[0051] The expression of SOX4 was detected in 14 cases of esophageal squamous cell carcinoma tissues and matched paracancerous tissues taken from Anyang Cancer Hospital of Henan Province. The results are as follows: figure 2 As shown, in 13 cases (92%), the expression level of SOX4 in cancer tissue was higher than that in normal tissue; in 9 cases (64%), the expression level of SOX4 in cancer tissue was more than 2 times higher than that in normal tissue.
[0052] RT-qPCR primers: the sense strand of SOX4 is 5'-GACCTGCTCGACCTGAAC C -3', the antisense strand is 5'-CCGGGCTCGAAG TTAAAATCC-3'; the sense strand of GAPDH is 5'-CTGGGCTACACTGAGCACC-3', and the antisense strand is 5' '-AAGTGGTCGTTGAGGGCAATG-3'. Reaction conditions: pre-denaturation at 95°C for 2min, denaturation at 95°C for 20S, annealing at 60°C for 20S, extension at 73°C for 30S, 40 cycles.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com