Unlock instant, AI-driven research and patent intelligence for your innovation.

Small interfering RNA (ribonucleic acid), short hairpin RNA and recombined carrier for SOX4 gene targets, and application of recombined carrier

A technology of SOX4 and recombinant vectors, applied in genetic engineering technology, biomedicine, and molecular biology, can solve problems such as low transfection efficiency, inability to express siRNA persistently, and short-term inhibition of target gene expression, and achieve anti-tumor application value Effect

Inactive Publication Date: 2016-11-16
SHENZHEN UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Initially RNA interference sampling was the method of synthesizing siRNA in vitro, but its application was limited by the disadvantages of low transfection efficiency, persistent expression of siRNA transferred into cells, and short-term inhibition of target gene expression.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small interfering RNA (ribonucleic acid), short hairpin RNA and recombined carrier for SOX4 gene targets, and application of recombined carrier
  • Small interfering RNA (ribonucleic acid), short hairpin RNA and recombined carrier for SOX4 gene targets, and application of recombined carrier
  • Small interfering RNA (ribonucleic acid), short hairpin RNA and recombined carrier for SOX4 gene targets, and application of recombined carrier

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Firstly, for the SOX4 gene, the small interfering RNA sequence is designed according to the principles commonly used in the field, and the corresponding short hairpin RNA sequence is synthesized.

[0034] The sense strand sequence of small interfering RNA is 5'-GCGACAAGAUCCCUUUCAU-3', and the antisense strand sequence is 5'-AUGAAAGGGAUCUUGUCGC-3'.

[0035] The sense strand sequence of short hairpin RNA is 5'-GATCCGCGACAAGATCCCTTTCATTTCAAGAGAAT

[0036] GAAAGGGATCTTGTCGCTGA-3';

[0037] The sense strand sequence is 5'-AGCTTCAGCGACAAGATCCCTTTTCATTCTCTTGAAATGAAAGGGA

[0038] TCTTGTCGCG-3'.

[0039] The region targeting SOX4 is: 5'-GCGACAAGATCCTTTCAT-3'.

[0040]In the sense strand, GCGACAAGATCCCTTTCATTTCAAGAGAATGAAAGGGATCTTGTCGC constitutes the stem-loop structure of RNA formed after transcription, and TTCAAGAGA forms a loop.

[0041] In the antisense strand, GCGACAAGATCCTTTCATTCTCTTGAAATGAAAGGGATCTTGTCGC constitutes the stem-loop structure of RNA formed after transcri...

Embodiment 2

[0044] Construction of interfering RNA recombinant vector targeting SOX4

[0045] Synthetic DNA sequence: the sense strand and the antisense strand were dissolved in double distilled water, respectively, at a concentration of 1 mg / mL. Take 2 μL each, add double-distilled water to 50 μL, mix evenly, place in a 95°C water bath for 5 minutes, and cool naturally to room temperature. The resulting annealed double-stranded DNA can be stored in a -20°C refrigerator for future use.

[0046] The map of pSilencer 4.1-CMV neo plasmid is as follows figure 1 As shown, the interfering RNA DNA sequence is inserted between HindIII (463) and BamHI (516).

[0047] Mix 1 μg of pSilencer empty vector plasmid, 1 μL (10 units) of each endonuclease HindIII and BamHI, 2 μL of 10X digestion buffer and an appropriate volume of double distilled water to make the total volume reach 20 μL, and react at 37°C for 30 minutes. After the reaction, add 2 μL of 10X DNA loading buffer to 1% agarose gel electro...

Embodiment 3

[0050] Expression of SOX4 in Esophageal Squamous Cell Carcinoma Cells

[0051] The expression of SOX4 was detected in 14 cases of esophageal squamous cell carcinoma tissues and matched paracancerous tissues taken from Anyang Cancer Hospital of Henan Province. The results are as follows: figure 2 As shown, in 13 cases (92%), the expression level of SOX4 in cancer tissue was higher than that in normal tissue; in 9 cases (64%), the expression level of SOX4 in cancer tissue was more than 2 times higher than that in normal tissue.

[0052] RT-qPCR primers: the sense strand of SOX4 is 5'-GACCTGCTCGACCTGAAC C -3', the antisense strand is 5'-CCGGGCTCGAAG TTAAAATCC-3'; the sense strand of GAPDH is 5'-CTGGGCTACACTGAGCACC-3', and the antisense strand is 5' '-AAGTGGTCGTTGAGGGCAATG-3'. Reaction conditions: pre-denaturation at 95°C for 2min, denaturation at 95°C for 20S, annealing at 60°C for 20S, extension at 73°C for 30S, 40 cycles.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology, genetic engineering technology and biological medicine, in particular to a small interfering RNA (ribonucleic acid), a short hairpin RNA and a recombined carrier for SOX4 gene targets, and application of the recombined carrier. The small interfering RNA comprises a positive-sense strand shown as SEQ ID NO.1 and an antisense strand shown as SEQ ID NO.2. The short hairpin RNA comprises a positive-sense strand shown as SEQ ID NO.3 and an antisense strand shown as SEQ ID NO.4. The recombined carrier comprising the short hairpin RNA can be transcribed in a host cell to obtain SOX4-shRNA, the small interfering RNA can be generated after the SOX4-shRNA is processed by the host cell, a messenger RNA of SOX4 is targeted, expression of the SOX4 is reduced, the gene silencing effect is caused, multiplication of esophageal squamous carcinoma cells is inhibited effectively, and aging of the esophageal squamous carcinoma cells induced by chemotherapeutic adriamycin is promoted, so that the recombined carrier has application value in tumor resistance, and the foundation is laid for further research on the function of the SOX4 in aging and escaping of tumor cells and for research and development of targeted SOX4 drugs.

Description

technical field [0001] The invention relates to the fields of molecular biology, genetic engineering technology and biomedicine, in particular to a small interfering RNA, a short hairpin RNA, a recombinant vector and an application aimed at the SOX4 gene target. Background technique [0002] my country is a country with a high incidence of esophageal cancer. According to data released by the National Cancer Center in 2015, the incidence of esophageal cancer in the national tumor registration area ranks 6th in cancer incidence (21.6 / 100,000 people), and the death rate ranks 4th. . The incidence of esophageal cancer in my country has obvious regional characteristics, mainly concentrated in Henan, Hebei, Shanxi, northern Sichuan, northern Jiangsu, and Shantou and Meixian in Guangdong. Esophageal squamous cell carcinoma is more common than esophageal adenocarcinoma in terms of pathological classification. At present, the treatment of esophageal cancer is mainly based on surgery...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/86A61K48/00A61P35/00
CPCA61K31/713C12N15/113C12N15/86C12N2310/14C12N2310/531C12N2710/10143C12N2740/15043C12N2800/107
Inventor 郑多韩荣飞肖田徐亚菲胡跃明汪天富
Owner SHENZHEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More