Modified entry vector pRMG-C and application thereof

A carrier, prmg-c technology, applied in the direction of carrier, nucleic acid carrier, and the use of carrier to introduce foreign genetic material, etc., can solve the problems of high price and inability to replicate in large quantities, so as to reduce experiment cost, save experiment cost, and save experiment time Effect

Inactive Publication Date: 2016-12-14
SHANDONG PEANUT RES INST
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

1. The entry carrier pENTR / D-Topo is expensive, and a 20-time kit needs 2875 yuan; 2. The entry carrier pENTR / D-Topo is a linear carrier, which cannot be copied in large quantities and will gradually be consumed as it is used; 3. The entry vector pENTR / D-Topo confers kanamycin resistance in E. coli, and most plant expression vectors are also kanamycin resistance selection vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified entry vector pRMG-C and application thereof
  • Modified entry vector pRMG-C and application thereof
  • Modified entry vector pRMG-C and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Construction of entry vector pRMG-C

[0027] 1. The artificially synthesized sequence is shown as SEQ ID No: 1 multiple cloning site DNA fragment (Shanghai Shenggong Biological Engineering Co., Ltd.), the DNA fragment sequentially contains restriction enzymes SalI, SacI, SphI, BamHI, HindIII , XhoI, PstI, KpnI, EcoRI recognition sequences, the artificially synthesized multiple cloning site basically covers the recognition sites of commonly used restriction enzymes, and the recognition sites of the endonucleases have a specific arrangement sequence, which can facilitate genes Restriction digestion-ligation cloning, while the traditional entry vector pENTR TM / D-TOPO does not contain these restriction enzyme recognition sites.

[0028] Synthetic multiple cloning site DNA fragment (SEQ ID No: 1): 414bp

[0029] TGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGCGGCCGCCCCCTTCACCAACGAC...

Embodiment 2

[0042] Example 2: Application of the entry vector pRMG-C

[0043] In the present invention, the key gene AhETR1 of the peanut ethylene signal pathway is taken as an example. First, it is subcloned into the entry vector pRMG-C modified by the present invention (in the specific experimental process, you can choose to use restriction enzyme digestion-ligation or use Obtained by cloning technology), and then recombined into overexpression vector pMDC32 (kanamycin resistance), BD vector pLAW10 (kanamycin resistance) and AD vector pLAW11 (ampicillin resistance) for yeast two-hybrid Penicillin resistance). The specific experimental operations are as follows:

[0044] 1) Obtaining the entry clone of peanut AhETR1 gene (take the obligatory cloning technique as an example)

[0045] Using Huayu 31 young leaf cDNA as template, AhETR1-F and AhETR1-R as primers (Table 1, the underlined part is the sequence homologous to the modified entry vector), using high-fidelity enzyme Phusion (Lifetechnolo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a modified entry vector pRMG-C and application thereof. A commercial cloning vector serves as the framework of the modified entry vector pRMG-C, and a section of artificially synthesized sequence is added and comprises recombinase recognition sites attL1 and attL2 and a section of multiple cloning sites in the middle; besides, an ampicillin resistance gene is replaced with a chloramphenicol resistance gene. A peanut ethylene signal pathway key gene AhETR1 is subcloned to pRMG-C with the seamless cloning technology, then AhETR1 is recombined to various vectors through an LR reaction, and it is proved that the entry vector pRMG-C can be applied to the LR reaction without digestion. By means of the entry vector pRMG-C, the problem that an adopted commercial entry vector is expensive is solved, and the tedious steps of digestion and the like are omitted; the entry vector pRMG-C has important application value.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a modified entry vector pRMG-C and its application. Background technique [0002] In the process of plant gene function research, vector construction is an essential link. The usual method is to first ligate the target gene to a cloning vector (such as pMD18-T simple, etc.), then cut the gene fragment with a suitable restriction endonuclease, and connect the related vector that has been digested with the same restriction endonuclease. Using this method is often limited by the difficulty of selecting restriction enzymes. Gateway recombinant cloning technology overcomes the limitations of traditional cloning technology based on restriction endonucleases, cloning the target gene into the entry vector (pENTR / D-Topo), and relying on the specific recombination site and recombinase (LR Clonase ), efficiently and quickly clone the target gene to any other recipient vector (Destinatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/63C12N15/65
CPCC12N15/11C12N15/63C12N15/65C12N2310/10C12N2800/50C12N2800/80
Inventor 孙全喜苑翠玲王传堂王秀贞唐月异吴琪王志伟
Owner SHANDONG PEANUT RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap