A 5'-utr element and its application in production
A component and purpose technology, applied in the field of L-alanine fermentation production, can solve the problems of heavy metabolic burden and poor stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0170] Example 1. Construction of E.coli K-12 W3110△metA△ilvA△lysA△tdh△tdcC△sstT
[0171] Using Escherichia coli K12 W3110 as the starting strain, the metA gene (the gene encoding homoserine succinyltransferase), the ilvA gene (the gene encoding threonine deaminase), and the lysA gene (the gene encoding the decarboxylation of diaminopimelic acid) were sequentially deleted. enzyme gene), tdh gene (the gene encoding threonine dehydratase), tdcC gene (the gene encoding the threonine uptake transporter) and sstT gene (the gene encoding the threonine uptake transporter), to obtain the chassis engineering bacteria , named it E.coli K-12W3110△metA△ilvA△lysA△tdh△tdcC△sstT.
[0172] 1. Knock out the metA gene
[0173] (1) The genomic DNA of Escherichia coli K12 W3110 was used as a template, and the primer pair composed of WY569 and WY570 was used for PCR amplification to obtain DNA fragment I-A (upstream region of the metA gene).
[0174] (2) Using the genomic DNA of Escherichia coli...
Embodiment 2
[0226] Example 2. Attenuator mutants regulate the expression of the lacZ gene
[0227] 1. Construction of recombinant plasmid pACYC184-P PL
[0228] 1. Synthesize the double-stranded DNA molecule shown in sequence 13 of the sequence listing (promoter P PL ).
[0229] 2. Using the double-stranded DNA molecule prepared in step 1 as a template, the primer pair composed of WY843 and WY842 is used for PCR amplification to obtain a PCR amplification product.
[0230] WY843: TGC TCTAGA CAATTCCGACGTCTAAGAAA;
[0231] WY842: CCC AAGCTT GGTCAGTGCGTCCTGCTGAT.
[0232] 3. Take the PCR amplification product obtained in step 2, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the digested product.
[0233] 4. Take the pACYC184 plasmid, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the vector backbone (about 4.1 kb).
[0234] 5. Ligate the digested product of step 3 with the vector backbone of step 4 t...
Embodiment 3
[0290] Embodiment 3, attenuator mutant regulates the expression of gfp gene
[0291] 1. Construction of recombinant plasmids
[0292] Construct the following six recombinant plasmids: pACYC184-P PL -thrLA-gfp914, pACYC184-P PL -thrLA-gfp1630, pACYC184-P PL -thrLA-gfp1629, pACYC184-P PL -thrLA-gfp1628, pACYC184-P PL -thrLA-gfp1627 and pACYC184-P PL -thrLA-gfp913.
[0293] pACYC184-P PL -thrLA-gfp914 with pACYC184-P PL -thrLA-lacZ914 differs only in that: the lacZ gene shown in sequence 15 of the sequence listing is replaced by specific DNA molecule X.
[0294] pACYC184-P PL -thrLA-gfp1630 with pACYC184-P PL -thrLA-lacZ1630 differs only in that: the lacZ gene shown in sequence 15 of the sequence listing is replaced by a specific DNA molecule X.
[0295] pACYC184-P PL -thrLA-gfp1629 with pACYC184-P PL -thrLA-lacZ1629 differs only in that: the lacZ gene shown in sequence 15 of the sequence listing is replaced by a specific DNA molecule X.
[0296] pACYC184-P PL -thr...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap