Application of tissue-specific promoter to regulation and control of crop yield

A tissue-specific, promoter technology, applied in the field of plant genetic engineering, can solve the problems of incompatible plant type, high plant height, and plant sterility.

Inactive Publication Date: 2017-03-29
HANGZHOU RUIFENG BIOTECH LIMITED
View PDF5 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, plants that use the constitutive promoter 35S promoter to promote the expression of the TEL gene will show sterility, reduced seed setting rate, delayed maturity, excessive plant height, excessive ear position, and uncoordinated plant type, etc., which affect plant yield.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of tissue-specific promoter to regulation and control of crop yield
  • Application of tissue-specific promoter to regulation and control of crop yield
  • Application of tissue-specific promoter to regulation and control of crop yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1. Cloning of tissue-specific promoters

[0043] 1. Cloning of reproductive tissue-specific promoters

[0044] Obtaining the ZmGA20ox1 promoter (pZmGA20ox1) of maize (Zea mays) gibberellin synthase gene: Design PCR primers pZmGA20ox1-F (5'TAAGCTTCTGCCATGACGTGATTGTCCCTGGC) and pZmGA20ox 1-R (5'GGGATCCAGGAGGGAGGAAGCAGAGGAGGAG) to the genome of commercial maize variety Zhengdan 958 As a template, pZmGA20ox1 was obtained by PCR amplification. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 2 minutes, repeating 30 cycles; and then 72°C for 10 minutes. The obtained PCR product of approximately 2 kb was cloned into the T-vector pMD19. Then, the corresponding promoter pZmGA20ox1 was obtained by double digestion with HindIII and BamHI, and DNA sequence determination showed that the nucleotide sequence of the promoter was correct (SEQ ID NO: 1).

[0045] Cloning of OsGA20ox1 promoter (pOsGA20ox1), a key enzyme ge...

Embodiment 2

[0068] Cloning of embodiment 2.TEL gene

[0069] Cloning of TE1 gene cDNA in maize (Zea mays): PCR primers ZmTE1-F (5'GAGGATCCAACAGAATTCATGGGTGGGTTC) and ZmTE1-R (5'GCGGTCTAGATTACTAGTCGTCGTAGCCAAGC) were designed and amplified by PCR using the total cDNA of commercial maize variety Zhengdan 958 as a template The cDNA fragment of TE1 is about 2 kb in size. The PCR reaction conditions are: 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 2 minutes, repeating 33 cycles; 72°C for 10 minutes. The obtained PCR product of approximately 2 kb was cloned into the T-vector pMD19. Then, ZmTE1 was obtained by double digestion with BamHI and XbaI, and DNA sequence determination showed that its nucleotide sequence was correct (SEQ ID NO: 29). Afterwards, the cDNA obtained by enzyme digestion and the synthetic terminator ter1 (nucleotide sequence is SEQ ID NO: 33) are connected by XbaI to obtain a nucleotide sequence with a structure of (BamHI)ZmTE1-ter1(KpnI) for use ...

Embodiment 3

[0072] Example 3. Construction of the expression vector of the TEL gene regulated by the tissue-specific promoter

[0073] The binary vector pCambia1300-G10 vector (Internationl Pat.No.PCT / CN2012 / 087069:SEQ ID NO.49) contains a glyphosate-tolerant gene (EPSPS) (as a marker gene for transformation) and the Multiple cloning sites.

[0074] The tissue-specific promoter cloned in Example 1 and the TEL gene cloned in Example 2 can be connected through BamHI and BamHI, or isozyme BamHI and BglII to form a "tissue-specific promoter-TEL gene-terminator -pZmUbi-EPSPS-terminator" ( figure 1 ), the T-DNA vector obtained by the above method is shown in Table 2.

[0075] Table 2: T-DNA vectors composed of tissue-specific promoters and TEL genes

[0076] Promoter Gene T-DNA vector name pZmGA20ox-1 ZmTE1 pCambia1300-pZmGA20ox-1-ZmTE1-pZmUbi-1174 pZmAUX1 ZmTE1 pCambia1300-pZmAUX1-ZmTE1-pZmUbi-1174 pOsARGOs ZmTE1 pCambia1300-pOsARGOs-ZmTE1-pZmUbi-117...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a tissue-specific promoter to the regulation and control of the crop yield. According to the application, the tissue-specific promoter is used for regulating and controlling the expression of a crop TEL gene to realize the improvement of the crop yield, wherein the tissue-specific promoter comprises a promoter with transcriptional activity on at least one or more than one tissue or organ of a crop stem tip mitogenetic region, a flower tip mitogenetic region, a flower primordium, an inflorescence, a tassel, a seed and a root; the effect that a series of adverse influence brought by a constitutive promoter can be effectively avoided by regulating and controlling the overexpression of the TEL gene in plants by the tissue-specific promoter is disclosed for the first time; the crop yield relevant property is effectively improved, so that a novel balance is formed in aspects of source, translocation and sink; and the crop yield is improved.

Description

[0001] (1) Technical field [0002] The invention belongs to the field of plant genetic engineering. Specifically, the invention relates to a gene that can affect plant growth through timing, fixed-point and quantitative regulation through a tissue-specific promoter and its application in the improvement of transgenic crops. The method can be used to regulate the yield-related traits of plants, and finally achieve the purpose of significantly improving crop yield. [0003] (2) Background technology [0004] Through genetic modification, the traits of crops can be improved, such as gaining insect resistance, herbicide resistance, increasing yield, enhancing drought resistance, and disease resistance. Improving the traits of crops is also the core content in the cultivation of new crop varieties, which is of great value. [0005] High yield is a complex trait affected by many factors such as germplasm, climate, cultivation and fertilizer. However, germplasm is one of the most d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113A01H5/00
Inventor沈志成张先文王东芳林朝阳
OwnerHANGZHOU RUIFENG BIOTECH LIMITED