A miR-126 full-length gene knockout kit based on CRISPR-Cas9 technology and its application

A mir-126 and full-length gene technology, applied in the field of miR-126 gene knockout kits, can solve the problems of adverse effects on research, inaccurate sequence insertion and deletion, and the repair process is not under human control, etc., to overcome time-consuming The effects of cumbersomeness, reduced reagent cost consumption, simple construction steps and experimental operations

Active Publication Date: 2019-11-01
上海伯豪生物技术有限公司
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The most common site-directed shear editing technology of CRISPR / Cas9 technology is to design sgRNA for a single site to guide Cas9 to perform directional shearing on the target sequence (for example, "a gene knockout based on CRISPR-Cas9" disclosed in Chinese invention patent application CN105112445A technology miR-205 gene knockout kit"), the inherent non-homologous end-joining pathway (NHEJ) repair process in cells after cleavage will introduce random insertion and deletion gene mutations, this repair process is not under human control, resulting in Unnecessary and inaccurate sequence insertions and deletions of various types often produce ambiguous or invalid cell phenotypes, adversely affecting research
[0011] At present, there is no report about using CRISPR / Cas9 system to specifically knock out the full-length gene sequence of miR-126

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A miR-126 full-length gene knockout kit based on CRISPR-Cas9 technology and its application
  • A miR-126 full-length gene knockout kit based on CRISPR-Cas9 technology and its application
  • A miR-126 full-length gene knockout kit based on CRISPR-Cas9 technology and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Example 1. Vector construction

[0072] (1) miR-126 target design

[0073] For the miR-126 gene (gene name miR-126, gene ID number: 406913, see http: / / www.ncbi.nlm.nih.gov / gene / 406913 for gene details), download miR-126 from this website Genome sequence:

[0074] 5'-CGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAATAATGCGCCGTCCACGGCA-3', as shown in SEQ ID NO.1.

[0075] Use the online software Feng Zhang lab's Target Finder (http: / / crispr.mit.edu / ) to design sgRNA, input the miR-126 genome sequence and its upstream and downstream 50bp sequences, set and retrieve several sgRNA sequences, and analyze the sgRNA in The location on the gene sequence and the off-target (off-target) information of the sgRNA, from which the optimal 2 upstream target sequences and 3 downstream target sequences are respectively selected, as follows:

[0076] upstream:

[0077] sgRNA-1: TAATGTCCCGTCGCCAGCGG, as shown in SEQ ID NO.2;

[0078] sgRNA-2: GCCACGCCTCCGCTGGCGAC, as...

Embodiment 2

[0111] Example 2. Plasmid transfection and identification of miR-126 knockout activity in 293T cells and construction of 293T knockout miR-126 cell model

[0112] (1) Plasmid extraction

[0113] The Escherichia coli DH5α of the pSpCas9(BB)-2A-Puro plasmid respectively comprising sgRNA-1, sgRNA-2, sgRNA-3, sgRNA-4, and sgRNA-5 fragments verified by sequencing in Example 1 were each inoculated in 5 mL In LB liquid medium, culture overnight at 37°C with shaking. Plasmid extraction was performed on these bacterial liquids using an endotoxin-free mini-plasmid extraction kit (the kit was produced by Omega Company, the article number is D6948-02). The extracted plasmid is then precipitated with absolute ethanol in an ultra-clean bench, and then dissolved in sterile water for aseptic treatment of the plasmid.

[0114] (2) 293T cells were transfected with a pair of pSpCas9(BB)-2A-Puro-sgRNA plasmids containing sgRNA

[0115] 1) 293T cell culture

[0116] 293T cells were divided int...

Embodiment 3

[0152] Example 3 Construction of miR-126 knockout lung cancer cell model

[0153] 1) Transfection of lung cancer cells A549 cells

[0154] Co-transfect lung cancer cell A549 with pSpCas9(BB)-2A-Puro-sgRNA1 and pSpCas9(BB)-2A-Puro-sgRNA3 using Lipofectamine 2000. After 24 hours of transfection, use the complete medium containing 2 μg / mL puromycin to carry out drug treatment. After three days of drug sieving, the cells were collected.

[0155] 2) Knockout activity verification

[0156] Collect the A549 cells after the drug screening and the A549 cells without transfection, use the ultra-micro sample genotype identification kit (Nanjing Yaoshunyu Biotechnology Co., Ltd., KC-101) for sample processing, and use as shown in Table 10 PCR primers for PCR amplification identification.

[0157] Table 10

[0158] *Primer sequence (5'--3') *Primer name GAGGGAGGATAGGTGGGTTC, as shown in SEQ ID NO.19 mir126-test-Fw AGGCAGAGCCAGAAGACTCA, as shown in SEQ ID NO.20 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a MiR-126 full-length gene knockout kit based on a CRISPR-Cas9 technology and an application thereof. CRISPR-Cas9 target sequences upstream and downstream a MiR-126 gene are preferably selected, and sgRNA single strands are designed and synthesized for the target sequences and built into a carrier. Through 293T cell strain transfection, sgRNA and trRNA constitute a specific recognition structure. Thus, Cas9 enzyme is guided to specifically shear the corresponding sequences at the two ends of the MiR-126 gene. Drug sieving is carried out constantly to get a MiR-126 full-length gene knockout cell strain. An optimal upstream and downstream sgRNA combination is obtained through drug sieving cell strain sequencing verification. The knockout efficiency of the combination is as high as 90% above. The kit built based on the combination can be used to carry out specific MiR-126 full-length gene knockout on a variety of cell lines such as 293T, a lung cancer cell line A 549 and a vascular endothelial cell HUVEC line.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to a miR-126 gene knockout kit, in particular to a kit capable of specifically knocking out the full-length gene sequence of miR-126 based on CRISPR-Cas9 technology. In addition, the invention also discloses the application of the kit. Background technique [0002] microRNA (microRNA) is a kind of non-coding single-stranded RNA molecule encoded by endogenous genes with a length of about 22 nucleotides, which is widely distributed in viruses, plants and higher mammals, and has many important functions in cells. the regulating effect. Each microRNA can have multiple target genes, and several microRNAs can also regulate the same gene. This complex regulatory network can not only regulate the expression of multiple genes through a microRNA, but also finely regulate the expression of a gene through the combination of several microRNAs. Therefore, the gene function exploration and appli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/63C12N15/113
CPCC12N15/113C12N15/63C12N2310/10C12N2310/141C12N2800/80
Inventor徐晓晶赵莹孙冰玉姚琴琴陆凌佳
Owner上海伯豪生物技术有限公司