DNA molecule STTM-miR482a and application thereof
A DNA molecule, the technology of PBI121, is applied in the field of plant genetic engineering to achieve the effect of enhancing resistance and increasing tomato yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1. Obtaining and functional identification of STTM-miR482a-transformed tomato.
[0023] 1. Construction of overexpression pBI-STTM-miR482a vector
[0024] 1. Vector pUC19-STTM-miR482a containing STTM-miR482a
[0025] Insert three nucleotides of CTA between the 12th and 13th nucleotides of the antisense complementary sequence of tomato miR482a mature body to obtain the Mimic sequence, and then add a 48nt linker sequence between the two identical sequences (Tandem Mimics) (GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT), after adding BamH I and Sac I restriction sites and protective bases at both ends of the gene, the STTM-miR482a nucleotide sequence shown in Sequence Table 1 was finally obtained. The STTM-miR482a nucleotide sequence was synthesized by Beijing Liuhe Huada Gene Co., Ltd. and connected to the pUC19 vector. After sequencing, the STTM-miR482a on the plasmid was sequence 1 (SEQ ID NO.1) in the sequence table, and the correct sequence The plasmid wa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



