Unlock instant, AI-driven research and patent intelligence for your innovation.

DNA molecule STTM-miR482a and application thereof

A DNA molecule, the technology of PBI121, is applied in the field of plant genetic engineering to achieve the effect of enhancing resistance and increasing tomato yield

Inactive Publication Date: 2017-05-31
DALIAN UNIV OF TECH
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the existing technology, the method of using STTM technology to improve plant disease resistance has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA molecule STTM-miR482a and application thereof
  • DNA molecule STTM-miR482a and application thereof
  • DNA molecule STTM-miR482a and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1. Obtaining and functional identification of STTM-miR482a-transformed tomato.

[0023] 1. Construction of overexpression pBI-STTM-miR482a vector

[0024] 1. Vector pUC19-STTM-miR482a containing STTM-miR482a

[0025] Insert three nucleotides of CTA between the 12th and 13th nucleotides of the antisense complementary sequence of tomato miR482a mature body to obtain the Mimic sequence, and then add a 48nt linker sequence between the two identical sequences (Tandem Mimics) (GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT), after adding BamH I and Sac I restriction sites and protective bases at both ends of the gene, the STTM-miR482a nucleotide sequence shown in Sequence Table 1 was finally obtained. The STTM-miR482a nucleotide sequence was synthesized by Beijing Liuhe Huada Gene Co., Ltd. and connected to the pUC19 vector. After sequencing, the STTM-miR482a on the plasmid was sequence 1 (SEQ ID NO.1) in the sequence table, and the correct sequence The plasmid wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses DNA molecule STTM-miR482a and application thereof. The DNA molecule has a nucleotide sequence shown as SEQ ID NO. 1. The invention further provides application of the DNA molecule, and a recombinant vector expressing the DNA molecule STTM-miR482a is used for regulating the expression of microRNA482a in plants. The specific method comprises the following steps: introducing the recombinant vector expressing the DNA molecule STTM-miR482a into a target plant, thereby obtaining the plant capable of regulating the expression of microRNA482a. Transgenic tomatoes are obtained by inhibiting the expression of miR482a in wild tomatoes, and compared with the wild tomatoes, the transgenic tomatoes have the advantage that the disease resistance is enhanced; and moreover, the DNA molecule STTM-miR482a disclosed by the invention has important significances for cultivating disease-resistant plant varieties so as to improve the crop yield.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to a STTM-miR482a and its application in inhibiting the function of plant microRNA482a. Background technique [0002] MicroRNA (miRNA) is a kind of endogenous RNA with a length of about 22 nt. It is one of the important post-transcriptional regulatory factors in organisms and participates in the regulation of plant growth and development and stress response. The RNA-induced silencing complex composed of mature miRNA and AGO1 protein cleaves the target gene or inhibits its translation, thereby playing a regulatory role. Recently, studies have found that the IPS1 gene and miR399 in Arabidopsis can be combined through complementary base pairing, and the IPS1 gene forms a three-base mismatch loop at the cleavage site, which prevents miR399 from pairing. The IPS1 gene is cut, and at the same time, the IPS1 gene is prevented from being degraded. When IPS1 is overexpres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00
CPCC12N15/113C12N15/8205C12N15/8218C12N15/8282C12N2310/10
Inventor 栾雨时杨广磊崔军姜宁肖裕
Owner DALIAN UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More