DNA molecule STTM-miR482a and application thereof
A DNA molecule, the technology of PBI121, is applied in the field of plant genetic engineering to achieve the effect of enhancing resistance and increasing tomato yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1. Obtaining and functional identification of STTM-miR482a-transformed tomato.
[0023] 1. Construction of overexpression pBI-STTM-miR482a vector
[0024] 1. Vector pUC19-STTM-miR482a containing STTM-miR482a
[0025] Insert three nucleotides of CTA between the 12th and 13th nucleotides of the antisense complementary sequence of tomato miR482a mature body to obtain the Mimic sequence, and then add a 48nt linker sequence between the two identical sequences (Tandem Mimics) (GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT), after adding BamH I and Sac I restriction sites and protective bases at both ends of the gene, the STTM-miR482a nucleotide sequence shown in Sequence Table 1 was finally obtained. The STTM-miR482a nucleotide sequence was synthesized by Beijing Liuhe Huada Gene Co., Ltd. and connected to the pUC19 vector. After sequencing, the STTM-miR482a on the plasmid was sequence 1 (SEQ ID NO.1) in the sequence table, and the correct sequence The plasmid wa...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap