Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid aptamer wyz-5 of ovarian mucinous carcinoma cell 3ao and its screening method and application

A nucleic acid aptamer, WYZ-5 technology, applied in the screening process, pharmaceutical formulations, biochemical equipment and methods, etc., can solve the problems of lack of specific markers of ovarian mucinous carcinoma, unsatisfactory pertinence, instability, etc. , to achieve good pharmacokinetic properties, no immunogenicity, and good reproducibility

Active Publication Date: 2019-04-30
嘉兴慧泉生物科技有限公司
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the diagnosis of ovarian cancer, the main methods used include B-ultrasound, CT, MRI, laparoscopy and serum tumor marker examination. These diagnostic methods are mainly based on morphological criteria and lack specific markers related to ovarian mucinous carcinoma.
In addition, all ovarian cancers are usually treated with the same approach, a comprehensive treatment strategy of surgery combined with chemotherapy, which is not ideally targeted
Based on monoclonal antibody technology, targeted therapy strategies developed in recent years have shown unique advantages in improving the survival rate of patients with ovarian mucinous carcinoma, but the antibody itself has some defects, such as immunogenicity, instability, batch-to-batch differences, etc., so that it has certain limitations in clinical practical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer wyz-5 of ovarian mucinous carcinoma cell 3ao and its screening method and application
  • Nucleic acid aptamer wyz-5 of ovarian mucinous carcinoma cell 3ao and its screening method and application
  • Nucleic acid aptamer wyz-5 of ovarian mucinous carcinoma cell 3ao and its screening method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Screening of nucleic acid aptamer WYZ-5:

[0046] The screening method of the nucleic acid aptamer WYZ-5 of the ovarian mucinous carcinoma cell 3AO comprises the following steps:

[0047] (1) Preparation of screening library:

[0048]Entrust Sangon Bioengineering Co., Ltd. to synthesize a single-stranded DNA library (5'-AGCTGCTATACTACTAGCTAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTAGCGATAGCTAGCTT-3'); take 1 tube of 1OD single-stranded DNA library, centrifuge at high speed for 2min; gently open the tube cap in a fume hood, add 300μL binding Buffer (4.5g / L glucose in DPBS, 100mg / L yeast tRNA, 1g / L BSA, 5mM MgCl 2 ), vortex and oscillate to dissolve; seal the cap of the centrifuge tube with parafilm, bathe in 95°C water for 5 minutes, rapidly ice-water bath for 2 minutes; centrifuge at high speed for 2 minutes, and set aside.

[0049] (2) Reverse screening of SKOV3 cells: inhale the library prepared in step (1) into a 100mm-diameter petri dish with a gro...

Embodiment 2

[0057] Example 2: Analysis of the sequence of the nucleic acid aptamer WYZ-5:

[0058] After 12 rounds of screening, the positive screen supernatant of 3AO cells was recovered, and Shanghai Passino Biotechnology Co., Ltd. was entrusted to use high-throughput sequencing technology to analyze the library sequence. The analysis process is: PCR amplification enrichment library, and adding Sequencing adapters and Index parts were placed; the purified library was selected by gel electrophoresis; the quality control of the library was performed using the Agilent 2100 Bioanalyzer through the Agilent High Sensitivity DNA Kit; the library was quantified using the Quant-iT PicogGreen dsDNAAssay Kit; Bridge PCR amplification of the template, annealing of sequencing primers, and sequencing while synthesizing; and comparison and enrichment analysis of the sequencing results.

[0059] Using the UNAFold network platform to analyze under physiological conditions (37°C, 0.137M Na + , 0.001M Mg...

Embodiment 3

[0060] Example 3: Analysis of the binding ability of nucleic acid aptamer WYZ-5 to ovarian mucinous carcinoma cell 3AO:

[0061] 1. Inoculate the target cells 3AO in a 24-well plate (50,000 / well), at 37°C, 5% CO 2 Cultivate for 24h.

[0062] 2. Configure the FITC-labeled single-stranded DNA (including the nucleic acid aptamer WYZ-5 and the unscreened single-stranded DNA library) into a solution with a concentration of 0nM, 10nM, 50nM, 100nM, and 200nM with a binding buffer; 95°C Water bath for 5 minutes, rapid ice water bath for 2 minutes.

[0063] 3. Wash the cells twice with binding buffer, add 200 μL of the single-stranded DNA solution with the above-mentioned gradient concentration to each well, and incubate on ice for 30 minutes.

[0064] 4. After incubation, discard the supernatant and scrape the cells with a cell scraper; wash twice with binding buffer, and resuspend the cells with a volume of 250 μL.

[0065] 5. Use the FACSAria flow cytometer of BD Company to measu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nucleic acid aptamer WYZ-5 of ovarian mucinous cancer cells 3AO and a screening method and application thereof. The sequence of the nucleic acid aptamer WYZ-5 is 5'AGCTGCTATACTAGCTAAAGCATTCGATGCCAACCGATGAGACCCGTCCCGCTAGTCGGACCCGTAGCGATAGCTAGCTT-3'. According to the screening method, based on the SELEX screening technique, ovarian serous cancer cells SKOV3 and normal ovarian epithelial cells IOSE are used as inverse screening cells, ovarian mucinous cancer cells 3AO are used as normal screening cells, and the nucleic acid aptamer in specific binding with ovarian mucinous cancer cells 3AO is screened out. The nucleic acid aptamer has the advantages of being high in specificity and affinity, capable of being synthesized and modified in vitro, stable in chemical property, excellent in pharmacokinetics property, free of immunogenicity and the like.

Description

technical field [0001] The invention relates to a nucleic acid aptamer WYZ-5 of ovarian mucinous carcinoma cell 3AO, a screening method and application thereof. Background technique [0002] Mucinous carcinoma of the ovary is poorly sensitive to chemotherapeutic drugs and often has a poor prognosis. Therefore, more targeted studies are needed to find better treatments to improve the survival rate of patients with mucinous carcinoma of the ovary. In the diagnosis of ovarian cancer, the main methods used include B-ultrasound, CT, MRI, laparoscopy and serum tumor marker examination. These diagnostic methods are mainly based on morphological criteria and lack specific markers related to ovarian mucinous carcinoma. . In addition, all ovarian cancers usually use the same treatment method, that is, a comprehensive treatment strategy of surgery combined with chemotherapy, which is not ideally targeted. Based on monoclonal antibody technology, targeted therapy strategies developed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115C12Q1/6886G01N33/574A61K31/7088A61P35/00
CPCC12N15/1048C12N15/115C12N2310/16C12N2310/531C12N2320/13G01N33/57449C12Q2565/519
Inventor 吴冬黄慧娟何春妮林朝雅
Owner 嘉兴慧泉生物科技有限公司