Method for information storage with DNA (Deoxyribonucleic Acid)
An information storage and DNA sequence technology, applied in the field of information storage, can solve the problems of high difficulty in sequence synthesis, sequencing and reading, discontinuous storage, and increased storage costs, so as to reduce the cost of synthesis and sequencing and improve storage and reading. Improve efficiency and reduce data recovery errors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Embodiment 1 Stores and extracts the digitized information of "Hello, World! Hello, World!" mixed in Chinese and English
[0047] to combine figure 2 Shown, at first the text file (26B) of " Hello, World! Hello, the world!" that Chinese and English words and punctuation are mixed is converted into quaternary BitDNA coding sequence data (DNA complete sequence) according to the method of the present invention, as follows:
[0048] TACATCTTTCGATCGATCGGACGAACAATGTGTCGGTGACTCGATCTAACATGCTACGGTCCAAGCTTCCTTCGGTGCGGCGGACAGAGCTACGCACTTCGCTGCTTTCAGAGCGGCGGACAAT.
[0049] Break the entire DNA sequence above into three DNA fragments, which are as follows:
[0050] DNA fragment 1: TACATCTTTCGATCGATCGGACGAACAATGTGTCGGTGACTCGA;
[0051] DNA fragment 2: TCTAACATGCTACGGTCCAAGCTTCCTTCGGTGCGGCGGACAGA;
[0052] DNA fragment 3: GCTACGCACTTCGCTGCTTTTCAGAGCGGCGGACAAT.
[0053] According to the output DNA format, the above-mentioned 3 DNA fragments were constructed into 3 sequences with ...
Embodiment 2
[0062] Example 2 Store and extract the digitized information of the picture "emoji.jpg" (3.83KB)
[0063] Will image 3 The shown emoji expression image file "emoji.jpg" (3.83KB) in jpg format is converted into quaternary BitDNA encoded data according to the encoding method of the present invention, and the DNA full sequence of 15708 bases is obtained, as shown in sequence 1;
[0064] The full DNA sequence was divided into 357 DNA fragments with a length of 44 nt according to the non-overlapping interrupt method, which were constructed as 357 output DNA sequences with a length of 100 nt according to the output DNA format (flanking primer sequence length 20 nt and index coding sequence length 8 nt ), that is, to complete the conversion of the digital information mixed in Chinese and English to the DNA sequence; then according to the 357 output DNA sequences obtained above, use an oligonucleotide synthesizer to prepare a DNA library and store it on a gene chip, thus completing t...
Embodiment 3
[0066] Embodiment 3 stores and extracts the digitized information (4.18KB) of the audio "example audio-laughter.mp3"
[0067] The sample audio file "Example Audio-Laughter.mp3" (4.18KB) in MP3 format is converted into quaternary BitDNA coded data according to the coding method of the present invention, and the DNA full sequence of 17148 bases is obtained, as shown in sequence 2;
[0068] The full DNA sequence was divided into 389 DNA fragments with a length of 44 nt and 1 DNA fragment with a length of 32 nt according to the non-overlapping interrupt method, which were constructed into 390 output DNA sequences with a length of 100 nt according to the output DNA format (flanking primers The length of the sequence is 20nt and the length of the index coding sequence is 8nt), that is, the conversion of the digital information of the mixed Chinese and English to the DNA sequence is completed; then according to the 390 output DNA sequences obtained above, a DNA library is prepared by ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap