Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of recombinant bacillus subtilis that accumulates n-acetylneuraminic acid and its application

A technology of Bacillus subtilis and acetylneuraminic acid, which is applied in the field of genetic engineering, can solve problems such as insufficient metabolic flow intensity, and achieve the effects of good application prospect, easy use and simple construction method.

Active Publication Date: 2020-11-06
JIANGNAN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The N-acetylneuraminic acid metabolic pathway currently constructed in subtilis mainly uses UDP-N-acetylglucosamine as a precursor, and the metabolic flow is from substrate glucose to N-acetylglucosamine precursor UDP-N-acetylglucosamine It is necessary to strengthen the action of three enzymes, glucosamine-fructose-6-phosphate transaminase (glmS), phosphoglucosamine isomerase (glmM), and UDP-N-glucosamine pyrophosphorylase (gcaD), which may easily lead to insufficient metabolic flux , so it is necessary to find new and efficient anabolic pathways

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of recombinant bacillus subtilis that accumulates n-acetylneuraminic acid and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Construction of recombinant fragments

[0032]According to the sequence information of the plasmid p43NMK-Cegna1 (constructed in the early stage of this experiment), the primers GNA1-F: 5'-AACGACAAGAGGATGGTGCTGAATTGATAGGTGGTATGTTTTTCGCTTGAAC-3', GNA1-R: 5'-CCTGTGTGAAATTGTTATCCGCTCTTAAAAGCGCTGGGTCATAAAATTACAG were designed with sequences of SEQ ID NO.4 and SEQ ID NO.5 respectively. -3', using the above-mentioned primers to use the plasmid pP43NMK-Cegna1 as a template to amplify the glucosamine acetylase encoding gene GNA1 containing the P43 promoter; according to the Bacillus subtilis (Bacillus subtilis 168) genome as a template, Ribosomal protein L25 gene (CTC, GenBank: NC_000964.3), design homology arm primers on both sides, sequence as SEQ ID NO.6 and SEQ ID NO.7 left homology arm primer: ctc-1F: 5' -ACGGGGAAGTCCAAATTAATATCG-3', ctc-1R: 5'-TTCAAGCGAAAACATACCACCTATCAATTCAGCACCATCCTCTTGTCGTT-3', the sequences are the right homology arm of SEQ ID NO. 8 and SEQ ...

Embodiment 2

[0033] The construction of embodiment 2 recombinant plasmid

[0034] According to the N-acetylglucosamine isomerase gene AGE in Candida (Anabaena sp.CH1, GenBank: DQ661858.1) published on NCBI, the gene was synthesized by Bacillus subtilis-preferred codon optimization, and the designed sequences are SEQ Primers of ID NO.12 and SEQ ID NO.13: AGE-F: 5'-ATAAAGTGATAGCGGTACCATTATAGGTAAGAGAGGAATGTACACATGGGCAAAAACTACAAGCTCTG-3', AGE-R: 5'-ACGATGTAGATGTTAGACATGTGTACATTCCTCTCTTACCCCGGGTTATGAAAGTGCTTCAAACTGTTGCC-3', using the above primers to synthesize N-acetylglucosamine isomer The enzyme gene is used as the template to amplify the AGE gene fragment; according to the N-acetylneuraminic acid synthase gene NeuB of Escherichia coli (Escherichiacoli K1, GenBank: U05248.1) published on NCBI, after optimized codon preferences of Bacillus subtilis, the gene Synthesize and design primers with sequences of SEQ ID NO.14 and SEQ ID NO.15: NeuB-F: 5'-ATGTCTAACATCTACATCGTGGCAGAAAT-3', NeuB-R: 5'-C...

Embodiment 3

[0035] Example 3 Construction of recombinant CPZC fragment Bacillus subtilis

[0036] The constructed recombinant fragment CPZC was transformed into Bacillus subtilis (Bacillus subtilis 168ΔnagPΔnagPΔgamPΔgamAΔnagAΔnagBΔ1dhΔpta::lox72). Using GNA1-F and GNA1-R primers to select transformants for colony PCR, an 864 bp band appeared, verifying that the recombinant Bacillus subtilis B6C was successfully constructed.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses bacillus subtilis for accumulating N-acetylneuraminic acid to recombine and an application thereof, and belongs to the field of genetic engineering. According to the bacillus subtilis, bacillus subtilis 168-delta-nagP delta-nagP delta-gamP delta-gamA delta-nagA delta-nagB delta-1dh delta-pta:: lox72 are taken as expression hosts, through the over-expression of glucosamine acetylase coding geneS GNA 1 which are derived from saccharomyces cerevisiae S288C, N-acetyl-glucosamine epimerase (AGE) which is derived from anabaena sp. CH1 and N-N-acetylneuraminic acid synthase (NeuB) which is derived from escherichia coli K1, genetically engineered bacteria of the bacillus subtilis for accumulating N-acetylneuraminic acid are obtained, the yield of N-acetylneuraminic acid reaches 190mg / L, and bacillus subtilis further lays a foundation for the process that the bacillus subtilis is transformed by metabolic engineering to produce the N-acetylneuraminic acid.

Description

technical field [0001] The invention relates to a recombinant Bacillus subtilis that accumulates N-acetylneuraminic acid and its application, and belongs to the field of genetic engineering. Background technique [0002] N-Acetylneuraminic acid is a monosaccharide in living organisms, widely present in microorganisms and mammals. In the human body, N-acetylneuraminic acid is the first contact site for cell information transmission, and is involved in many physiological processes such as cell recognition and signal transduction. Therefore, N-acetylneuraminic acid is widely used to modulate IgG anti-inflammatory activity, enhance infant immunity, and promote infant brain development. At present, N-acetylneuraminic acid is mainly extracted from natural materials with relatively rich contents such as casein and bird's nest. Intermediate products, etc. are difficult to separate and cause serious environmental pollution. [0003] Bacillus subtilis is widely used as a host for t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12P19/26A23L33/135C12R1/125
CPCC12N1/20C12N9/1029C12N9/1085C12N9/90C12P19/26C12Y203/01129C12Y205/01056
Inventor 陈坚堵国成刘延峰张晓龙
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com