A kind of recombinant bacillus subtilis that accumulates n-acetylneuraminic acid and its application
A technology of Bacillus subtilis and acetylneuraminic acid, which is applied in the field of genetic engineering, can solve problems such as insufficient metabolic flow intensity, and achieve the effects of good application prospect, easy use and simple construction method.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Construction of recombinant fragments
[0032]According to the sequence information of the plasmid p43NMK-Cegna1 (constructed in the early stage of this experiment), the primers GNA1-F: 5'-AACGACAAGAGGATGGTGCTGAATTGATAGGTGGTATGTTTTTCGCTTGAAC-3', GNA1-R: 5'-CCTGTGTGAAATTGTTATCCGCTCTTAAAAGCGCTGGGTCATAAAATTACAG were designed with sequences of SEQ ID NO.4 and SEQ ID NO.5 respectively. -3', using the above-mentioned primers to use the plasmid pP43NMK-Cegna1 as a template to amplify the glucosamine acetylase encoding gene GNA1 containing the P43 promoter; according to the Bacillus subtilis (Bacillus subtilis 168) genome as a template, Ribosomal protein L25 gene (CTC, GenBank: NC_000964.3), design homology arm primers on both sides, sequence as SEQ ID NO.6 and SEQ ID NO.7 left homology arm primer: ctc-1F: 5' -ACGGGGAAGTCCAAATTAATATCG-3', ctc-1R: 5'-TTCAAGCGAAAACATACCACCTATCAATTCAGCACCATCCTCTTGTCGTT-3', the sequences are the right homology arm of SEQ ID NO. 8 and SEQ ...
Embodiment 2
[0033] The construction of embodiment 2 recombinant plasmid
[0034] According to the N-acetylglucosamine isomerase gene AGE in Candida (Anabaena sp.CH1, GenBank: DQ661858.1) published on NCBI, the gene was synthesized by Bacillus subtilis-preferred codon optimization, and the designed sequences are SEQ Primers of ID NO.12 and SEQ ID NO.13: AGE-F: 5'-ATAAAGTGATAGCGGTACCATTATAGGTAAGAGAGGAATGTACACATGGGCAAAAACTACAAGCTCTG-3', AGE-R: 5'-ACGATGTAGATGTTAGACATGTGTACATTCCTCTCTTACCCCGGGTTATGAAAGTGCTTCAAACTGTTGCC-3', using the above primers to synthesize N-acetylglucosamine isomer The enzyme gene is used as the template to amplify the AGE gene fragment; according to the N-acetylneuraminic acid synthase gene NeuB of Escherichia coli (Escherichiacoli K1, GenBank: U05248.1) published on NCBI, after optimized codon preferences of Bacillus subtilis, the gene Synthesize and design primers with sequences of SEQ ID NO.14 and SEQ ID NO.15: NeuB-F: 5'-ATGTCTAACATCTACATCGTGGCAGAAAT-3', NeuB-R: 5'-C...
Embodiment 3
[0035] Example 3 Construction of recombinant CPZC fragment Bacillus subtilis
[0036] The constructed recombinant fragment CPZC was transformed into Bacillus subtilis (Bacillus subtilis 168ΔnagPΔnagPΔgamPΔgamAΔnagAΔnagBΔ1dhΔpta::lox72). Using GNA1-F and GNA1-R primers to select transformants for colony PCR, an 864 bp band appeared, verifying that the recombinant Bacillus subtilis B6C was successfully constructed.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
