Bacillus subtilis for accumulating N-acetylneuraminic acid to recombine and application thereof

A technology of Bacillus subtilis and acetylneuraminic acid, applied in the field of genetic engineering, can solve problems such as insufficient metabolic flow strength, and achieve good application prospects, easy to use, and simple construction methods

Active Publication Date: 2017-07-07
JIANGNAN UNIV
View PDF2 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The N-acetylneuraminic acid metabolic pathway currently constructed in subtilis mainly uses UDP-N-acetylglucosamine as a precursor, and the metabolic flow is from substrate glucose to N-acetylglucosamine precursor UDP-N-acetylglucosamine It is necessary to strengthen the action of three enzymes, glucosamine-fructose-6-phosphate transaminase (glmS), phosphoglucosamine isomerase (glmM), and UDP-N-glucosamine pyrophosphorylase (gcaD), which may easily lead to insufficient metabolic flux , so it is necessary to find new and efficient anabolic pathways

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis for accumulating N-acetylneuraminic acid to recombine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Construction of embodiment 1 recombinant fragment

[0032]According to the sequence information of plasmid p43NMK-Cegna1 (constructed earlier in this experiment), primers with sequences such as SEQ ID NO.4 and SEQ ID NO.5 were designed GNA1-F: 5'-AACGACAAGAGGATGGTGCTGAATTGATAGGTGGTATGTTTTCGCTTGAAC-3', GNA1-R: 5'-CCTGTGTGAAATTGTTATCCGCTCTTAAAAGCGCTGGGTCATAAAATTACAG -3', use the above primers and use the plasmid pP43NMK-Cegna1 as a template to amplify the glucosamine acetylase encoding gene GNA1 containing the P43 promoter; according to the Bacillus subtilis (Bacillus subtilis 168) genome as a template, according to the 50S published on NCBI Ribosomal protein L25 gene (CTC, GenBank: NC_000964.3), design both sides of the homology arm primers, the sequences are as SEQ ID NO.6 and SEQ ID NO.7 left homology arm primer: ctc-1F: 5' -ACGGGGAAGTCCAAATTAATATCG-3', ctc-1R:5'-TTCAAGCGAAAACATACCACCTATCAATTCAGCACCATCCTCTTGTCGTT-3', the sequence is respectively the right homology arm ...

Embodiment 2

[0033] The construction of embodiment 2 recombinant plasmids

[0034] According to the N-acetylglucosamine isomerase gene AGE in Nostoc algae (Anabaena sp.CH1, GenBank: DQ661858.1) published on NCBI, the gene was synthesized after optimizing the preferred codon of Bacillus subtilis, and the designed sequences were SEQ The primers of ID NO.12 and SEQ ID NO.13: AGE-F: 5'-ATAAAGTGATAGCGGTACCATTATAGGTAAGAGAGGAATGTACACATGGGCAAAAACTACAAGCTCTG-3', AGE-R: 5'-ACGATGTAGATGTTAGACATGTGTACATTCCTCTTACCCCGGGTTATGAAAGTGCTTCAAACTGTTGCC-3', using the above primers to synthesize isomeric N-acetylglucose The enzyme gene was used as a template to amplify the AGE gene fragment; according to the N-acetylneuraminic acid synthase gene NeuB of Escherichia coli (Escherichia coli K1, GenBank: U05248.1) published on NCBI, after optimizing the preferred codon of Bacillus subtilis, Gene synthesis, primers designed with sequences of SEQ ID NO.14 and SEQ ID NO.15: NeuB-F: 5'-ATGTCTAACATCATCGTGGCAGAAAT-3', Neu...

Embodiment 3

[0035] Embodiment 3 Construction of recombinant CPZC fragment Bacillus subtilis

[0036] The constructed recombinant fragment CPZC was transformed into Bacillus subtilis (Bacillus subtilis 168ΔnagPΔnagPΔgamPΔgamAΔnagAΔnagBΔ1dhΔpta::lox72). GNA1-F and GNA1-R primers were used to select transformants for colony PCR, and a band of 864bp appeared, verifying that the recombinant Bacillus subtilis B6C was successfully constructed.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses bacillus subtilis for accumulating N-acetylneuraminic acid to recombine and an application thereof, and belongs to the field of genetic engineering. According to the bacillus subtilis, bacillus subtilis 168-delta-nagP delta-nagP delta-gamP delta-gamA delta-nagA delta-nagB delta-1dh delta-pta:: lox72 are taken as expression hosts, through the over-expression of glucosamine acetylase coding geneS GNA 1 which are derived from saccharomyces cerevisiae S288C, N-acetyl-glucosamine epimerase (AGE) which is derived from anabaena sp. CH1 and N-N-acetylneuraminic acid synthase (NeuB) which is derived from escherichia coli K1, genetically engineered bacteria of the bacillus subtilis for accumulating N-acetylneuraminic acid are obtained, the yield of N-acetylneuraminic acid reaches 190mg / L, and bacillus subtilis further lays a foundation for the process that the bacillus subtilis is transformed by metabolic engineering to produce the N-acetylneuraminic acid.

Description

technical field [0001] The invention relates to a recombinant bacillus subtilis accumulating N-acetylneuraminic acid and its application, belonging to the field of genetic engineering. Background technique [0002] N-acetylneuraminic acid is a kind of monosaccharide in organisms, which widely exists in microorganisms and mammals. In the human body, N-acetylneuraminic acid is the first contact site for cell information transmission, and participates in multiple physiological processes such as cell recognition and signal transduction. Therefore, N-acetylneuraminic acid is widely used to regulate IgG anti-inflammatory activity, enhance infant immunity, and promote infant brain development. At present, N-acetylneuraminic acid is mainly extracted from relatively rich natural materials such as casein and bird’s nest. The products obtained are likely to cause allergic reactions, or they are synthesized by chemical methods under harsh conditions, and the high-temperature and high-p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P19/26A23L33/135C12R1/125
CPCC12N1/20C12N9/1029C12N9/1085C12N9/90C12P19/26C12Y203/01129C12Y205/01056
Inventor陈坚堵国成刘延峰张晓龙
OwnerJIANGNAN UNIV