Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for performing target knockout on paddy rice dwarfing gene SD1 by using CRISPR/Cas9 technology

A rice and gene technology, applied in the field of plant molecular biology and biology, can solve the problems of long cycle, high cost and heavy workload of dwarf rice lines, and achieve the effect of shortening the cycle of breeding

Active Publication Date: 2017-07-18
SHANGHAI ACAD OF AGRI SCI +1
View PDF2 Cites 37 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In the past, rice dwarf breeding mainly obtained dwarf rice varieties through mutagenesis, or introduced dwarf genes into other rice varieties through hybridization. large and costly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for performing target knockout on paddy rice dwarfing gene SD1 by using CRISPR/Cas9 technology
  • Method for performing target knockout on paddy rice dwarfing gene SD1 by using CRISPR/Cas9 technology
  • Method for performing target knockout on paddy rice dwarfing gene SD1 by using CRISPR/Cas9 technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] The coding region sequence of the rice SD1 gene is shown in SEQ ID NO.6.

[0027] In this example, the CRISPR / Cas9 editing target sequence is 20 bp in length, located at bases 108 to 127 of the SD1 coding region, and the edited target sequence is SEQ ID NO.1: AGGATGGAGCCCAAGATCC.

[0028] Synthesize two single-nucleotide primers based on the target sequence:

[0029] SD1-F1 (SEQ ID NO. 2): TGTGTGAGGATGGAGCCCAAGATCC

[0030] SD1-R1 (SEQ ID NO. 3): AAACGGATCTTGGGCTCCATCCTCA;

[0031] The primers SD1-F1 and SD1-R1 formed a dimer structure by annealing reaction, and then ligated with the BGK03 carrier fragment to construct the plasmid BGK03-SD1 containing the rice SD1 gene target sequence.

[0032] The BGK03-SD1 plasmid was transformed into Agrobacterium EHA105 by electric shock method, and the Agrobacterium EHA105 containing the BGK03-SD1 plasmid was streaked on an LB plate containing Kan (50 μg / μl) to obtain a single colony. Pick a single colony and inoculate it into 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for performing target knockout on paddy rice dwarfing gene SD1 by using CRISPR / Cas9 technology. The method comprises the following steps: according to the design principle of CRISPR / Cas9, determining target sites, edited by a CRISPR / Cas9 system, in a paddy rice dwarfing gene SD1 encoding region, designing a primer according to the sequence of the target sites, constructing a CRISPR / Cas9 carrier, converting paddy rice callus tissues by using an agrobacterium tumefaciens mediated method, and screening and identifying to finally obtain a SD1-mutated dwarfing paddy rice strain without transgenic DNA segments. The method is applied to breeding of the dwarfing paddy rice strain, so that the hybridization breeding work can be omitted, and the breeding period of the dwarfing paddy rice strain can be greatly shortened.

Description

technical field [0001] The invention belongs to the field of plant molecular biology and biotechnology, and in particular relates to a method for targeted knockout of rice dwarf gene SD1 based on CRIPSR / Cas9 genome editing technology. Background technique [0002] Rice is native to China and is one of the world's main food crops. China's rice sowing area accounts for 1 / 4 of the country's grain crops, while its output accounts for more than half. It is an important grain crop in my country. [0003] When humans began domesticating rice about 10,000 years ago, they selected an important gene related to high yield. The gene, called the semi-dwarf gene SD1, makes rice plants grow shorter, produce more grains, and be more resistant to lodging. Rice dwarf breeding around this gene was a key element of the world's first Green Revolution in the mid-20th century. [0004] SD1 is involved in the biosynthesis of gibberellin and encodes a GA20 oxidase (GA20ox) consisting of 389 amino...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/84A01H5/00C12N9/22
CPCC12N9/0071C12N9/22C12N15/8205C12N15/8213C12N15/8261C12N2810/10C12Y114/11012
Inventor 储黄伟曹黎明
Owner SHANGHAI ACAD OF AGRI SCI