Sesame sicol1 and sicol2 genes and their application

A sesame and gene technology, applied to two sesame flowering genes and their application fields in plant photoperiod and flowering time regulation, can solve the problems such as the cloning and functional verification of sesame photoperiod regulation genes that have not yet been reported, and reach the growth period. The effect of shortening and shortening the flowering period

Active Publication Date: 2020-06-23
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to incomplete statistics, CO gene persons have been cloned from nearly 20 species such as Arabidopsis thaliana, rice, corn, soybean, tomato, and grape, but the cloning and functional verification of sesame photoperiod regulation genes have not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sesame sicol1 and sicol2 genes and their application
  • Sesame sicol1 and sicol2 genes and their application
  • Sesame sicol1 and sicol2 genes and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Cloning of sesame flowering genes SiCOL1 and SiCOL2

[0030] Utilize forward primer CCCGGGATGCTGAAGCTCCA (shown in SEQ ID No.5) and reverse primer GAGCTCTCAGAAGGACGGGA (shown in SEQ ID No.6) and forward primer CCCGGGATGCTGAAAGTCGA (shown in SEQ ID No.7) and reverse primer GAGCTCTCAGAATGATGGAA (shown in SEQ ID No. .8) respectively cloned from the sesame variety "Zhongzhi 13".

Embodiment 2

[0031] Embodiment 2: the intermediate vector used for cloning of sesame flowering genes SiCOL1 and SiCOL2 is pEASY-T1 (see image 3 ).

[0032] The PCR product amplified from Example 1 was directly cloned into pEASY-T1 according to the TA cloning method. The ligation product was transformed into Escherichia coli DH5α, and multiplied in it, and the positive clones were sequenced and screened to obtain SiCOL1 and SiCOL2, whose gene sequences are shown in SEQ ID No.1 and SEQ ID No.2; the amino acid sequence of the protein encoded by them As shown in SEQ ID No.3 and SEQ ID No.4.

Embodiment 3

[0033] Example 3: Structural analysis of proteins encoded by sesame flowering genes SiCOL1 and SiCOL2

[0034] The amino acid sequence homology between sesame flowering genes SiCOL1 and SiCOL2 genes encoded protein is 70%, and the homology with Arabidopsis CO protein is 57% and 61%, respectively. And SiCOL1 and SiCOL2 proteins have the same conserved domains as Arabidopsis CO: CCT domain and zinc finger domain. Among them, the CCT domain is a kind of domain specific to flowering genes. Therefore, it can be speculated that SiCOL1 and SiCOL2 have a similar flowering-promoting function to Arabidopsis CO genes. In the CCT domain, there are five and four amino acid differences between sesame SiCOL1 and SiCOL2 proteins and Arabidopsis CO protein; in the zinc finger domain, the first B-box of SiCOL2 is missing, these structures and sequences The difference may result in the functional differences of sesame SiCOL1 and SiCOL2 in regulating flowering.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering and relates to sesame SiCOL1 and SiCOL2 genes and application thereof. The sesame SiCOL1 gene has a nucleotide sequence shown as SEQ ID No. 1 or a nucleotide sequence which is formed by being substituted with, deleting or adding one or more nucleotides with equal functions. The sesame SiCOL2 gene has a nucleotide sequence shown as SEQ ID No. 2 or a nucleotide sequence which is formed by being substituted with, deleting or adding one or more nucleotides with equal functions. Overexpression of the SiCOL1 and SiCOL2 genes can change a plant growth stage, can promote flowering of a plant and can be used for solving the asynchronous flowering period problem in cross breeding as well as the growth period control problem, the photoperiod-sensitive problem and the introduction problem of various crops, vegetables, fruits and flowers.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to two sesame flowering genes and their application in the regulation of plant photoperiod and flowering time. Background technique [0002] Sesamum (Sesamum indicum L.) belongs to the family Flaxaceae, and is an ancient oil crop with a cultivation history of more than 5,000 years. At present, it is widely distributed between 40 degrees south latitude and 45 degrees north latitude, concentrated in tropical and subtropical regions of Asia and Africa. As a valuable oil plant with rich nutrition, strong functionality and good health care effect, it is deeply loved by people. The unsaturated fatty acid content of sesame oil is as high as 85%, and it is rich in anti-oxidation, anti-cancer, and blood-fat-lowering sesamin. It is known as the "queen of oils". Sesame is a short-day plant, and its flowering is mainly regulated by photoperiod. The flowering time of sesame in different regi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/20
CPCC07K14/415C12N15/8269C12N15/827
Inventor魏鑫周瑢张秀荣刘盼黎冬华
OwnerINST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI