An application of a PTRE1 gene in regulation and control of plant heat resistance

A technology of plants and gramineous plants, applied in the fields of botany and genetic engineering, can solve problems such as shortened growth period and reduced water use efficiency

Active Publication Date: 2017-11-17
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, under the condition of elevated nighttime temperature, the decrease of corn, wheat and soybean yield cannot be all attributed to the increase of nocturnal respiration rate, and the decrease of water use efficiency and shortening of growth period are also one of the reasons for the decrease of crop yield.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An application of a PTRE1 gene in regulation and control of plant heat resistance
  • An application of a PTRE1 gene in regulation and control of plant heat resistance
  • An application of a PTRE1 gene in regulation and control of plant heat resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0044] As an embodiment of the present invention, the gene encoding the PTRE1 protein is cloned into an appropriate vector by conventional methods, and the recombinant vector with the foreign gene is introduced into the plant cells that can express the PTRE1 protein , making the plant cell express PTRE1 protein. Plants overexpressing PTRE1 protein can be obtained by regenerating said plant cells into plants. Preferably, the gene encoding the PTRE1 protein is transferred into plants using the Agrobacterium transformation method.

[0045] As used herein, the forward connection refers to: the connection between the coding gene of PTRE1 and the expression vector is a positive connection, that is, the coding gene is connected to the vector in the direction of 5'→3'. Usually, the gene encoding PTRE1 is located downstream of the promoter in the expression vector, that is, the 3' end of the promoter is connected downstream to the 5' end of the encoding gene. The coding gene is opera...

Embodiment 1

[0050] Example 1. Isolation and phenotype analysis of PTRE1 gene

[0051] In the research on the regulation of proteasome activity, the inventors found that PTRE1 gene can regulate the heat tolerance of plants.

[0052] Plants with PTRE1 overexpression were obtained by constructing PTRE1 overexpression vector and transfecting Arabidopsis plants.

[0053] 1. Construction of PTRE1 overexpression vector

[0054] The vector construction method is as follows: use the genome of Arabidopsis Col as the amplification template, amplify the PTRE1 cDNA gene by primer P1 and primer P2, and insert it into the polyclonal polyclonal of the vector pCAMBIA1302 (the plasmid has its own GFP coding sequence) by restriction endonuclease ligation. site, a PTRE1 overexpression vector was obtained, called pCAMBIA1302-PTRE1, which could express 35S-driven PTRE1-GFP (p35S::PTRE1-GFP).

[0055] Primer P1: CATG CCATGG CGAATTCTCAGACGGTGA (SEQ ID NO: 4);

[0056] Primer P2: GGACTAGTTATAAAATCTGAACCGCCG ...

Embodiment 2

[0061] Phenotype Analysis of Plants Overexpressed in Embodiment 2, PTRE1 Gene

[0062] In this example, the phenotypic traits of ptre1 mutants and PTRE1 gene overexpressed transgenic plants were detected.

[0063] 1. Establishment of Arabidopsis mutants

[0064] In order to study the physiological function of PTRE1, the inventors searched the Arabidopsis T-DNA insertion mutant library (http: / / signal.salk.edu / cgi-bin / tdnaexpress) and obtained a possible T-DNA insertion mutant Salk_034353. After seed propagation, screening and identification, it was proved that the insertion position was on the first intron. About 300 plants of the progeny population were verified by T-DNA insertion. It was found that in the seedlings of plants heterozygous for T-DNA insertion, there was no significant difference in growth and development status from the wild type except for the abnormal embryonic development in the fruit pod. The development of plants homozygous for the insertion was markedl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of a PTRE1 gene in regulation and control of plant heat resistance. A characteristic that the PTRE1 gene can regulate and control proteasome activity so that a high amount of production and degradation of denatured under heat stimulation conditions are further influenced and plant heat resistance is controlled and regulated is found for the first time by the inventor. Accordingly, the PTRE1 gene can be applied in plant heat resistance improvement breeding to breed a variety having heat resistance.

Description

technical field [0001] The invention belongs to the fields of botany and genetic engineering, and more specifically, the invention relates to the application of PTRE1 gene in regulating plant heat resistance. Background technique [0002] Climate change in the world today has become a hot issue that governments and ordinary people are increasingly concerned about. Disasters such as the melting of polar glaciers, Hurricane Katrina, the Indian Ocean tsunami, the heat wave in India, and the snow and ice disaster in southern China remind us of the huge changes in the global climate all the time. As the homeland on which human beings live, the earth not only breeds human civilization, but also carries and maintains the entire ecosystem. The animals, plants, microorganisms, mountains, rivers, lakes, and oceans on it provide the necessary resources for human survival and development. indispensable condition. However, global climate change is seriously threatening the stability of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00
CPCC07K14/415C12N15/8271
Inventor薛红卫杨宝军
OwnerCAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI