Rare indels in psoriasis and their risk prediction methods for psoriasis

A psoriasis and biomarker technology, applied in the fields of molecular genetics and dermatology, can solve the problems of large sample size variation detection, high detection cost, difficulty of InDels detection, etc., to reduce operation time and detection cost, and detect The effect of high accuracy

Active Publication Date: 2020-12-04
THE FIRST AFFILIATED HOSPITAL OF ANHUI MEDICAL UNIV +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Due to the limitations of the existing technology, for example, only known loci can be detected, typing can only be performed based on SNPs, and it is impossible to detect mutations in a short period of time for very large samples, and the detection accuracy of InDels is not good. High, high detection cost, etc. Based on the detection of more related gene sites and different biomarkers, due to the difficulty of InDels detection itself, there is currently no more accurate and feasible method for InDels detection, so we A relatively accurate and reliable method has been established for the detection of InDels, and subsequent experimental verification has also proved that our method is accurate and reliable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 The acquisition of rare InDels for psoriasis

[0029] For the peripheral blood samples of 9964 patients with sporadic psoriasis and 9969 cases of normal people collected in recent years, the inventor searched and consulted relevant literature, and collected genes related to psoriasis as much as possible. In addition, not limited to Reports in psoriasis research, research results related to immune diseases will also be included in the scope of gene collection, and probes are designed for these genes, and then the target region capture chip is customized, combined with the HiSeq 2000 high-throughput sequencer. Targeted region capture sequencing was performed on 9,964 cases, resulting in 90 base-length read-pair sequencing sequences with an average sequencing depth of 64X per sample.

[0030] Use the BWA comparison software to compare the obtained sequencing sequence to the human genome reference sequence (version 36.3), and save the comparison result in the BAM ...

Embodiment 2

[0040] Example 2 Predicting the Risk of Psoriasis Occurrence Using Rare InDels for Psoriasis

[0041] (1) Collect peripheral blood from patients with possible psoriasis;

[0042] (2) Extract DNA from peripheral blood by salting out method;

[0043] (3) According to the manufacturer's instructions, construct a library from 3 micrograms of genomic DNA. Genomic DNA is diluted with Tris-EDTA buffer and fragmented into fragments of about 500 bp. Use T4 polynucleotide enzyme, T4 DNA polymerase and Klenow polymerase to modify the ends of the fragments Fill in, and then add an A base at the end of the fragment. Using T4 DNA ligase, the illuminated sequencing adapters with T bases can be bound to the fragments with A base tails, and finally, the adapter-connected fragments are amplified by PCR.

[0044] (4) According to the manufacturer's instructions (Roche NimbleGen), for each sample library, use the designed probes to perform fragment hybridization capture at 65°C for 70 hours, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular genetics and dermatology and particularly relates to rare InDels of psoriasis and a risk prediction method for psoriasis. The InDels comprise chr3_158211991_IATGATAACTGGAAGGAGAAGGATGATAACTGGAAGGAG, splice site InDel of an LEKR1 gene; chr2_9954176_IAGT, splice site InDel of an AFF3 gene; chr4_89258443_DAAAAGTG, splice site InDel of an ABCG2 gene; chr19_50869251_DCCTGCTCATCTTGAGTTTGTTCAGGTGGGA, splice site InDel of a GIPR gene; chr10_74828010_DCT, frameshift mutation InDel of an ANXA7 gene; chr11_85114805_IC, frameshift mutation InDel of an SYTL2 gene; and chr3_45983483_DCT, frameshift mutation InDel of an FYCO1 gene. Sequencing can be efficiently carried out on genes related to psoriasis and fast analysis can be carried out by combining high-performance computing resources, thereby obtaining a mutation detection result, and the detection accuracy rate on the InDels is higher than that of other prior arts.

Description

technical field [0001] The invention relates to the fields of molecular genetics and dermatology, in particular to the rare InDels of psoriasis and its risk prediction method for the occurrence of psoriasis. Background technique [0002] Psoriasis is a chronic autoimmune complex disease, the main clinical features are erythema, scales and itching of the lesioned skin, local and systemic skin lesions may occur. [0003] At present, many related studies have been carried out on psoriasis, but its etiology has not been clarified. It is generally believed that factors related to the disease include genetics, living habits, immunity, infection, and endocrine factors. [0004] A prior art solution that is relatively close to the present application: use snp array to genotype the known gene region of the target sample, and perform differential analysis on the obtained snp typing information. [0005] Due to the limitations of the existing technology, for example, only known loci c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6883C12Q1/6869C12N15/11
CPCC12Q1/6869C12Q1/6883C12Q2600/156C12Q2535/122
Inventor孙良丹杨振军王文俊甄琪郑晓冬钱文君吴静徐凤萍王文婧
OwnerTHE FIRST AFFILIATED HOSPITAL OF ANHUI MEDICAL UNIV