Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rare InDels of psoriasis and risk prediction method for psoriasis

A risk prediction and psoriasis technology, applied in the fields of molecular genetics and dermatology, can solve the problems of large sample size mutation detection, high detection cost, difficulty of InDels detection, etc., to reduce operation time and detection cost, and achieve accurate detection. high rate effect

Active Publication Date: 2017-11-24
THE FIRST AFFILIATED HOSPITAL OF ANHUI MEDICAL UNIV +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Due to the limitations of the existing technology, for example, only known loci can be detected, typing can only be performed based on SNPs, and it is impossible to detect mutations in a short period of time for very large samples, and the detection accuracy of InDels is not good. High, high detection cost, etc. Based on the detection of more related gene sites and different biomarkers, due to the difficulty of InDels detection itself, there is currently no more accurate and feasible method for InDels detection, so we A relatively accurate and reliable method has been established for the detection of InDels, and subsequent experimental verification has also proved that our method is accurate and reliable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 The acquisition of rare InDels for psoriasis

[0029] For the peripheral blood samples of 9964 patients with sporadic psoriasis and 9969 cases of normal people collected in recent years, the inventor searched and consulted relevant literature, and collected genes related to psoriasis as much as possible. In addition, not limited to Reports in psoriasis research, research results related to immune diseases will also be included in the scope of gene collection, and probes are designed for these genes, and then the target region capture chip is customized, combined with the HiSeq 2000 high-throughput sequencer. Targeted region capture sequencing was performed on 9,964 cases, resulting in 90 base-length read-pair sequencing sequences with an average sequencing depth of 64X per sample.

[0030] Use the BWA comparison software to compare the obtained sequencing sequences to the human genome reference sequence (version 36.3), and save the comparison results in the fo...

Embodiment 2

[0040] Example 2 Using rare InDels for psoriasis to predict the risk of psoriasis

[0041] (1) Collect peripheral blood from patients with possible psoriasis;

[0042] (2) extract the DNA in the peripheral blood with the salting-out method;

[0043] (3) According to the manufacturer's instructions, construct a library from 3 micrograms of genomic DNA, dilute the genomic DNA with Tris-EDTA buffer, and break into fragments of about 500bp, and use T4polynucleotide enzyme, T4DNApolymerase and Klenow polymerase to complement the ends of the fragments level, and then add an A base to the end of the fragment. Using T4DNA ligase, the illuminate sequencing adapter with T base can be bound to the fragment with A base tail, and finally, the fragment with the adapter is amplified by PCR.

[0044] (4) According to the manufacturer's instructions (Roche NimbleGen), for each sample library, use the designed probes to perform fragment hybridization capture at 65°C for 70 hours, and then at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular genetics and dermatology and particularly relates to rare InDels of psoriasis and a risk prediction method for psoriasis. The InDels comprise chr3_158211991_IATGATAACTGGAAGGAGAAGGATGATAACTGGAAGGAG, splice site InDel of an LEKR1 gene; chr2_9954176_IAGT, splice site InDel of an AFF3 gene; chr4_89258443_DAAAAGTG, splice site InDel of an ABCG2 gene; chr19_50869251_DCCTGCTCATCTTGAGTTTGTTCAGGTGGGA, splice site InDel of a GIPR gene; chr10_74828010_DCT, frameshift mutation InDel of an ANXA7 gene; chr11_85114805_IC, frameshift mutation InDel of an SYTL2 gene; and chr3_45983483_DCT, frameshift mutation InDel of an FYCO1 gene. Sequencing can be efficiently carried out on genes related to psoriasis and fast analysis can be carried out by combining high-performance computing resources, thereby obtaining a mutation detection result, and the detection accuracy rate on the InDels is higher than that of other prior arts.

Description

technical field [0001] The invention relates to the fields of molecular genetics and dermatology, in particular to the rare InDels of psoriasis and its risk prediction method for the occurrence of psoriasis. Background technique [0002] Psoriasis is a chronic autoimmune complex disease, the main clinical features are erythema, scales and itching of the lesioned skin, local and systemic skin lesions may occur. [0003] At present, many related studies have been carried out on psoriasis, but its etiology has not been clarified. It is generally believed that factors related to the disease include genetics, living habits, immunity, infection, and endocrine factors. [0004] A prior art solution that is relatively close to the present application: use snp array to genotype the known gene region of the target sample, and perform differential analysis on the obtained snp typing information. [0005] Due to the limitations of the existing technology, for example, only known loci c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6869C12Q1/6883C12Q2600/156C12Q2535/122
Inventor 孙良丹杨振军王文俊甄琪郑晓冬钱文君吴静徐凤萍王文婧
Owner THE FIRST AFFILIATED HOSPITAL OF ANHUI MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com