Lasioderma serricorne chitin deacetylase gene 1 and application of dsRNA thereof in pest control
A deacetylase and chitin technology, applied in DNA/RNA fragments, applications, genetic engineering, etc., can solve the problems of insects with physiological dysfunction, insect molting development disorders, etc., and achieve the effect of high lethality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] Example 1: Full-length cDNA sequence and encoded amino acid of tobacco chitin deacetylase gene 1
[0017] 1) Identification of tobacco chitin deacetylase gene 1
[0018] The chitin deacetylase gene 1 was searched from the tobacco A transcriptome database using bioinformatics methods, and the homology analysis was performed using BLASTx in the NCBI database, and a tobacco A chitin deacetylase 1 gene was confirmed and screened full-length sequence.
[0019] 2) Full-length cDNA verification of tobacco alpha chitin deacetylase gene 1
[0020] Based on the above sequence of tobacco chitin deacetylase gene 1, specific full-length primers were designed using Primer premier5.0 software, wherein the upstream primer SEQ ID NO: 3 and the downstream primer SEQ ID NO: 4. The primers were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd.
[0021] Take 20 tobacco beta 5th instar larvae and freeze them quickly in liquid nitrogen, then grind them into fine powder in a mortar...
Embodiment 2
[0024] Embodiment 2: dsRNA synthesis of tobacco chitin deacetylase gene 1 fragment
[0025] Based on the full-length sequence of tobacco beetle SEQ ID NO: 1, use Primer premier5.0 software to design upstream primers containing T7 promoter TAATACGACTCACTATAGGG ACCTCTGTTGTATACTGATG (SEQ ID NO: 5) and downstream primers TAATACGACTCACTATAGGG CGTTCATCATCATTGTGAGT (SEQ ID NO: 6) (T7 promoter sequence is shown in italics), and the primers were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd. The plasmid frozen in the full-length cDNA verification process in Example 1 was thawed and diluted as a template, and the dsRNA primers designed above were used for PCR amplification to obtain a DNA fragment with a length of 474 bp and T7 promoter at both ends. The sequence is shown in SEQ ID NO:7. The PCR product purified by the kit was used as a template for dsRNA synthesis, and dsRNA was synthesized by in vitro transcription using the Transcript Aid T7 High Yield Transcription K...
Embodiment 3
[0026]Example 3: 5th instar larvae were killed by dsRNA injection of tobacco chitin deacetylase gene 1 fragment
[0027] 1) dsRNA injection of tobacco chitin deacetylase gene 1 fragment
[0028] Larvae with uniform size and health status on the third day of the fifth instar were selected for injection of the above-mentioned synthetic dsRNA. Nanoject II Auto-Nanoliter Injector (Drummond Scientific) was used for injection. The injection point was located at the first or second internode on the back of the larvae, operated slightly, and followed the direction of body fluid flow. The amount of dsRNA injected was 0.2-0.3 μg, and a dsGFP control group was set up, with 50 larvae in each group, and 3 biological replicates, a total of 150 larvae. After the injection, the worms were placed in an artificial climate chamber (temperature 27 ± 1°C, relative humidity 70 ± 5%, photoperiod L:D = 14:10 h), and fed with artificial diet.
[0029] 2) Detection of silencing efficiency of tobacco ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



