Check patentability & draft patents in minutes with Patsnap Eureka AI!

Lasioderma serricorne chitin deacetylase gene 1 and application of dsRNA thereof in pest control

A deacetylase and chitin technology, applied in DNA/RNA fragments, applications, genetic engineering, etc., can solve the problems of insects with physiological dysfunction, insect molting development disorders, etc., and achieve the effect of high lethality

Inactive Publication Date: 2018-01-16
GUIYANG UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

By disrupting or blocking the formation of chitin deacetylase in insects, the molt development of insects is disturbed, resulting in serious disorders of their physiological functions, so that insects cannot complete normal life activities and die

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lasioderma serricorne chitin deacetylase gene 1 and application of dsRNA thereof in pest control
  • Lasioderma serricorne chitin deacetylase gene 1 and application of dsRNA thereof in pest control
  • Lasioderma serricorne chitin deacetylase gene 1 and application of dsRNA thereof in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Example 1: Full-length cDNA sequence and encoded amino acid of tobacco chitin deacetylase gene 1

[0017] 1) Identification of tobacco chitin deacetylase gene 1

[0018] The chitin deacetylase gene 1 was searched from the tobacco A transcriptome database using bioinformatics methods, and the homology analysis was performed using BLASTx in the NCBI database, and a tobacco A chitin deacetylase 1 gene was confirmed and screened full-length sequence.

[0019] 2) Full-length cDNA verification of tobacco alpha chitin deacetylase gene 1

[0020] Based on the above sequence of tobacco chitin deacetylase gene 1, specific full-length primers were designed using Primer premier5.0 software, wherein the upstream primer SEQ ID NO: 3 and the downstream primer SEQ ID NO: 4. The primers were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd.

[0021] Take 20 tobacco beta 5th instar larvae and freeze them quickly in liquid nitrogen, then grind them into fine powder in a mortar...

Embodiment 2

[0024] Embodiment 2: dsRNA synthesis of tobacco chitin deacetylase gene 1 fragment

[0025] Based on the full-length sequence of tobacco beetle SEQ ID NO: 1, use Primer premier5.0 software to design upstream primers containing T7 promoter TAATACGACTCACTATAGGG ACCTCTGTTGTATACTGATG (SEQ ID NO: 5) and downstream primers TAATACGACTCACTATAGGG CGTTCATCATCATTGTGAGT (SEQ ID NO: 6) (T7 promoter sequence is shown in italics), and the primers were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd. The plasmid frozen in the full-length cDNA verification process in Example 1 was thawed and diluted as a template, and the dsRNA primers designed above were used for PCR amplification to obtain a DNA fragment with a length of 474 bp and T7 promoter at both ends. The sequence is shown in SEQ ID NO:7. The PCR product purified by the kit was used as a template for dsRNA synthesis, and dsRNA was synthesized by in vitro transcription using the Transcript Aid T7 High Yield Transcription K...

Embodiment 3

[0026]Example 3: 5th instar larvae were killed by dsRNA injection of tobacco chitin deacetylase gene 1 fragment

[0027] 1) dsRNA injection of tobacco chitin deacetylase gene 1 fragment

[0028] Larvae with uniform size and health status on the third day of the fifth instar were selected for injection of the above-mentioned synthetic dsRNA. Nanoject II Auto-Nanoliter Injector (Drummond Scientific) was used for injection. The injection point was located at the first or second internode on the back of the larvae, operated slightly, and followed the direction of body fluid flow. The amount of dsRNA injected was 0.2-0.3 μg, and a dsGFP control group was set up, with 50 larvae in each group, and 3 biological replicates, a total of 150 larvae. After the injection, the worms were placed in an artificial climate chamber (temperature 27 ± 1°C, relative humidity 70 ± 5%, photoperiod L:D = 14:10 h), and fed with artificial diet.

[0029] 2) Detection of silencing efficiency of tobacco ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lasioderma serricorne chitin deacetylase gene 1 and application of dsRNA thereof in pest control, and in particular discloses a method for acquiring chitin deacetylase gene 1fragments from a lasioderma serricorne transcriptome database, performing full-length cloning on the fragments and sequencing to obtain the gene full length with a sequence shown as SEQ ID NO: 1. dsRNA of the gene is designed and synthesized based on SEQ ID NO: 1 and injected to enter a lasioderma serricorne body cavity for specifically silencing target genes, and in the growth process, the lasioderma serricorne has skin darkening, shrinking and difficult ecdysis symptoms and finally dies. Multiple experiments prove that the fatality rate reaches 76% or higher. Due to the specificity and highfatality rate, the lasioderma serricorne chitin deacetylase gene can serve as a molecular target for pest control and provides a novel pathway for effective pest control.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of tobacco chitin deacetylase gene 1 and its dsRNA in pest control. Background technique [0002] Tobacco A Lasioderma serricorne (Fabricius), belonging to the family Anobiidae of the order Coleoptera, is a worldwide storage pest. The insect has a wide range of hosts and can harm various stored products such as tobacco, grain, spices, tea, and Chinese medicinal materials. Tobacco beetle mainly eats through larvae lurking in the host body, excreting a large amount of feces, leaving insect corpses, and producing peculiar smell, which seriously affects the yield and quality of stored products, and its occurrence hazards are relatively hidden. At present, the control of Tobacco beetles is mainly based on chemical fumigation, which not only brings food safety and human safety hazards, but also leads to different degrees of resistance to insecticides. It is necessary to e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/55C12N9/80C12N15/10C12N15/113A01N57/16A01P7/04
Inventor 杨文佳许抗抗陈春旭闫欣朱晓晔李灿
Owner GUIYANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More