Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for producing fertility attenuated plant

A plant and fertility technology, applied in the field of preparation of plants with reduced fertility, can solve problems such as failure of seed production, influence of photothermo-sensitive sterile materials, etc.

Active Publication Date: 2018-03-30
INST OF BOTANY CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the abnormal low temperature (<23 degrees) in summer will cause the failure of seed production, so the application of photothermo-sensitive sterile materials has been affected to a certain extent.
[0005] In addition to the influence of light and temperature on plant growth and development, humidity is also an important environmental factor, although the relationship between humidity and rice male sterility has not been reported at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing fertility attenuated plant
  • Method for producing fertility attenuated plant
  • Method for producing fertility attenuated plant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Embodiment 1, RNA interference prepares transgenic rice with reduced fertility

[0086] 1. Obtaining the RNA interference carrier of OsOSC8

[0087] 1. Acquisition of Gateway intermediate vector pDONR221 / osc8-1

[0088] According to the gene sequence of OsOSC8, the primers involved are as follows: the primer pair adopts the gateway technology of Invitrogen Company, the attB1 sequence is added to the 5' end of the sense strand primer, and the attB2 sequence is added to the 5' end of the antisense strand primer.

[0089] Primer pair 1: sense: 5'-AAAAAGCAGGCTGGCTGCACGGATAGAGTT-3' (SEQ ID NO: 3)

[0090] antisense: 5'-AGAAAGCTGGGTGCCTGTATGGCTGAGAAA-3' (SEQ ID NO: 4)

[0091] Extracted rice Zhonghua 11 (Orazy sativa L.ssp japonica; recorded in Zhong-Hai Ren et al., 2005, A rice quantitative trait locus for salt tolerance encodes a sodium transporter. Nature Genetics 37, 1141-1146; public available from Chinese Academy of Sciences Botanical The total RNA obtained from the ...

Embodiment 2

[0149] Embodiment 2, Utilize TILLING technology to screen and obtain the mutant with reduced fertility

[0150] 1. Using TILLING technology to screen for mutants with reduced fertility

[0151] 1. Design of primer pairs for mutagenizing the target plant seeds and for specifically amplifying the triterpene synthase coding gene in the target plant

[0152] 1) Mutagenesis target plant seeds

[0153] 20,000 Zhonghua No. 11 rice seeds were soaked in 2 mM sodium azide aqueous solution at room temperature 25° C. for 6 hours to obtain mutagenic seeds.

[0154] 2) Primer design

[0155] According to the rice triterpene synthase coding gene OsOSC8, a pair of primers for specifically amplifying the gene is designed, and the sequences are respectively:

[0156] Primer pair 2: forward primer OsOSC8T1F: GAGGTCAAGTCGTCTTCTGCAATTA (SEQ ID NO: 6); reverse primer OsOSC8T1R: ATTTGTCTGCGCTCTGCACATG (SEQ ID NO: 7);

[0157] Primer pair 3: forward primer OsOSC8T13F: GCTTAAAGGTAAATTTCAGGCTTCC (S...

Embodiment 3

[0232] Embodiment 3, restore fertility or improve fertility

[0233] The M3 seeds of the fertility-reducing mutant P34E8 were used in the following experiments.

[0234] Moisturizing treatment: sow the T0 generation RNA interference transgenic rice obtained by the above-mentioned RNAi-9, RNAi-12, RNAi-20, RNAi-21 obtained in Example 1 and the mutant P34E8 (S6) obtained in Example 2; During the flowering period (the 80th day to the 100th day after sowing is the flowering period), keep the growth humidity of the rice inflorescence at 80-100%, and restore the natural humidity (natural humidity 40-60%) after one week; the method for specifically maintaining the growth humidity of the rice inflorescence As follows: Cover the entire inflorescence with a plastic bag (specification: length × width = 27cm × 15cm) on the entire inflorescence of rice, pin the opening of the plastic bag with paper clips, or cover the entire inflorescence with plastic wrap, because the plastic wrap is easy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing a fertility attenuated plant. The invention provides an RNA interference vector and a transgenic plant obtained through introducing the RNA interferencevector to a target plant. The transgenic plant is 1) a sterile transgenic plant; or 2) a transgenic plant having a lower fertility than the target plant. The invention also provides a method for cultivating the target plant into a sterile mutant or a fertility attenuated mutant through sodium azide mutagenesis. Experiments prove that the invention provides multiple methods for preparing a sterileline or a fertility attenuated line. The methods comprise RNA interference or TILLING (Targeting Induced Local lesions IN Genomes) technology screening; and the sterile line produced through the methods lays a foundation for paddy rice heterosis and cross breeding.

Description

[0001] This application is a divisional application of Chinese patent application 201280006361.6 "A Method for Preparing Plants with Reduced Fertility" with a filing date of November 14, 2012. technical field [0002] The invention relates to the field of biotechnology, in particular to a method for preparing plants with reduced fertility. Background technique [0003] Plant male sterility is a botanical trait closely related to agricultural production, which is the result of the interaction between genotype expression and environment during plant development. The male sterility of the plant itself can be used as a genetic tool for the development and utilization of crop heterosis, recurrent selection, backcrossing and other breeding research without artificial emasculation. Use the male sterility of plants to breed various male sterile lines, and then use genetic engineering to produce hybrid seeds in large quantities, so that the heterosis of many crops, especially self-po...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/46
CPCC12N9/90C12N15/8213C12N15/8218C12N15/8287C12N15/8289C12Y504/99A01H1/06C12N15/113C12N2310/14
Inventor 漆小泉薛哲勇张英春徐霞刘丹
Owner INST OF BOTANY CHINESE ACAD OF SCI