Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Aspergillus flavus pathogenic gene rgfC and application thereof

A disease-causing gene, Aspergillus flavus technology, applied in the field of microbiology to achieve the effects of reducing usage, reducing toxicity, and shortening culture time

Active Publication Date: 2018-04-13
FUJIAN AGRI & FORESTRY UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In Aspergillus, however, there is no rgf3 Research reports on homologous genes, rgf3 The functional role of the gene's homolog in Aspergillus flavus and the effect of the homolog on the toxicity of Aspergillus flavus are still unknown

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus flavus pathogenic gene rgfC and application thereof
  • Aspergillus flavus pathogenic gene rgfC and application thereof
  • Aspergillus flavus pathogenic gene rgfC and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Embodiment 1, in Aspergillus flavus gfC gene knockout

[0062] Aspergillus flavus gfC Gene function in Aspergillus flavus morphogenesis and virulence expression, first knockout in Aspergillus flavus gfC Gene.

[0063] figure 2 A shows the strategy for gene knockout. in vitro construction gfCGene knockout fragments, through the method of homologous recombination, the chromosome gfC The 5.4 kb DNA fragment in the gene was used pyrG replacement, thereby knocking out the chromosomal gfC Gene.

[0064] The specific method is as follows:

[0065] Using the 5' primer AAGCGGAACAACTCAGCGTAC (SEQ ID NO.3); and the 3' primer GGGTGAAGAGCATTGTTTGAGGCTCTGCTGGTGTCAGGGACTAAG (SEQ ID NO.4); the upstream fragment of about 0.9 kb was amplified by PCR from the genomic DNA of the Aspergillus flavus wild-type strain;

[0066] Using 5' primer GCCTCAAAACAATGCTCTTCACCC (SEQ ID NO.5); and 3' primer GTCTGAGAGGAGGCACTGATGC (SEQ ID NO.6); amplify about 1.9kb of A. fumigatus genomic DNA ...

Embodiment 2

[0069] Embodiment 2, gfC The Effect of Gene Knockout on Sporulation of Aspergillus flavus

[0070] Knockout in Aspergillus flavus by homologous recombination gfC Gene, Southern blot analysis confirmed that the knockout was successful. to detect gfC Whether the gene deletion will affect the spore production of Aspergillus flavus, the present invention cultured it on the PDA medium under continuous light or dark conditions at 29°C for 6 days, and observed the spore production of the following strains. The wild-type strain WT produced a large number of green spores, while ⊿ gfC No sporulation was observed in the deletion strain, and the statistical analysis of the data also showed this point ( image 3 A, 3B).

[0071] This result shows that, gfC The deletion of the gene will seriously affect the sporulation of Aspergillus flavus.

Embodiment 3

[0072] Embodiment 3, gfC Effect of gene knockout on toxin production of Aspergillus flavus

[0073] to detect gfC Whether gene deletion will affect the toxin production of Aspergillus flavus, the present invention inoculates spores in YESSB liquid medium (2% yeast extract, 15% sucrose, 1% soybean peptone, pH 5.5) to a final concentration of 10 5 cells / ml, cultured statically for 5 days under continuous dark conditions at 29°C, extracted the toxin, and analyzed the toxin production of each strain by thin-layer chromatography. The results showed that the WT strain produced a large amount of aflatoxin AFB1, while ⊿ gfC The production of AFB1 was not detected in the deletion strain, and the statistical analysis of the data also showed this point ( Figure 4 ).

[0074] The above results show that, gfC The deletion of the gene will affect the toxin production of Aspergillus flavus.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an aspergillus flavus pathogenic gene rgfC and an application thereof in screening of medicines used for preventing and treating aspergillus flavus contamination. The inventionalso discloses a method for screening and inhibiting pathogenicity of aspergillus flavus or screening medicines capable of preventing and treating aspergillus flavus contamination. More specifically,the method disclosed by the invention contains the following steps: adding a to-be-screened candidate into an aspergillus flavus culture system, detecting transcriptional expression level of an rgfC gene in aspergillus flavus, comparing with a control group which is not added with the candidate, and determining the candidate is a potential medicine capable of inhibiting the pathogenicity of aspergillus flavus or preventing and treating the aspergillus flavus contamination if the transcriptional expression level of the rgfC gene in a test group is lower than that of the control group statistically.

Description

technical field [0001] The invention belongs to the field of microbiology, in particular to a pathogenic gene of Aspergillus flavus gfC And its application in screening drugs for preventing and controlling Aspergillus flavus pollution. Background technique [0002] Aspergillus flavus is a saprophytic fungus widely distributed in nature, with strong growth and diffusion ability. Aflatoxin can parasitize in grain, food and feed for growth and reproduction, and produce aflatoxin, among which aflatoxin B1 (Aflatoxin B1, AFB1) is the most harmful, with strong liver toxicity and carcinogenic effect. At present, 25% of the world's crops are polluted by mycotoxins every year, and the most serious one is aflatoxin pollution. It is common for peanuts and corn to be polluted by Aspergillus flavus in my country, and the contamination by Aspergillus flavus in livestock and poultry feed and aquatic feed is even more serious. Therefore, the pollution caused by Aspergillus flavus is very...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/31C12Q1/689C12Q1/6851
CPCC07K14/38C12Q1/6851C12Q1/689C12Q2531/113C12Q2563/107
Inventor 聂鑫怡李博文岳跃威李玲张轶汪世华
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com