Application of medicago truncatula MYB transcription factor MtMYB1
A transcription factor, alfalfa technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problem of different effects and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0038] Example 2 Expression characteristics of MtMYB1 in different organs of Medicago truncatula
[0039] The wild type R108 of Medicago truncatula and the mutant NF5676 were planted in the greenhouse with a photoperiod of 16h light / 8h dark. The roots, stems, leaves, flowers and pods 10 days after flowering of R108 and Medicago truncatula variant NF5676 were collected respectively. After the samples were taken, they were immediately frozen in liquid nitrogen and stored in a -80°C ultra-low temperature freezer for later use.
[0040] The extraction of total RNA was the same as in Example 1. Taking Medicago truncatula constitutive expression gene Actin as internal reference gene, its amplification primer is: Actin forward primer sequence: 5' TCAATGTGCCTGCCATGTATGT 3' (SEQ ID NO.7), Actin reverse primer sequence: 5' ACTCACACCGTCACCAGAATCC 3' (SEQ ID NO.8). Using cDNA from different tissues or organs of Medicago truncatula as templates, real-time fluorescent quantitative PCR an...
Embodiment 3
[0041] The genetic engineering application of embodiment 3MtMYB1
[0042] MtMYB1 was recombined into the pMD19-T cloning vector using the Novizan one-step cloning kit. reusing Invitrogen's Technology with ClonaseTMII kit, MtMYB1 was recombined into the plant expression vector pMDC83, transformed into Escherichia coli DH5α, and the transformation solution was spread on LB solid medium containing 50 mg / L hygromycin to screen for positive clones. After sequencing verification, the plasmid was extracted to obtain the pMDC83-MtMYB1 plant overexpression vector ( figure 2 ), pMDC83-MtMYB1 was transformed into Agrobacterium tumefaciens strain EHA105 by freeze-thaw method. pMDC83-MtMYB1 was transformed into Arabidopsis thaliana by Agrobacterium strain EHA105, cultured on MS medium containing 50mg / L hygromycin, and the transgenic plants with hygromycin resistance were obtained through preliminary screening.
[0043] Extract the genomic DNA of transgenic Arabidopsis thaliana with hy...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap