Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of a Myb-like transcription factor mtmyb1 from Medicago truncatula

A transcription factor, alfalfa technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problem of different effects and so on

Active Publication Date: 2020-10-30
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are a large number of MYB transcription factors, different MYB transcription factors play different biological functions. Therefore, the functions of new MYB transcription factors still need further experimental verification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a Myb-like transcription factor mtmyb1 from Medicago truncatula
  • Application of a Myb-like transcription factor mtmyb1 from Medicago truncatula
  • Application of a Myb-like transcription factor mtmyb1 from Medicago truncatula

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0038] Example 2 Expression characteristics of MtMYB1 in different organs of Medicago truncatula

[0039] The wild type R108 of Medicago truncatula and the mutant NF5676 were planted in the greenhouse with a photoperiod of 16h light / 8h dark. The roots, stems, leaves, flowers and pods 10 days after flowering of R108 and Medicago truncatula variant NF5676 were collected respectively. After the samples were taken, they were immediately frozen in liquid nitrogen and stored in a -80°C ultra-low temperature freezer for later use.

[0040] The extraction of total RNA was the same as in Example 1. Taking Medicago truncatula constitutive expression gene Actin as internal reference gene, its amplification primer is: Actin forward primer sequence: 5' TCAATGTGCCTGCCATGTATGT 3' (SEQ ID NO.7), Actin reverse primer sequence: 5' ACTCACACCGTCACCAGAATCC 3' (SEQ ID NO.8). Using cDNA from different tissues or organs of Medicago truncatula as templates, real-time fluorescent quantitative PCR an...

Embodiment 3

[0041] Example 3 Genetic Engineering Application of MtMYB1

[0042] MtMYB1 was recombined into the pMD19-T cloning vector using the Novizan one-step cloning kit. reusing Invitrogen's Technology with ClonaseTMII kit, MtMYB1 was recombined into the plant expression vector pMDC83, transformed into Escherichia coli DH5α, and the transformation solution was spread on LB solid medium containing 50 mg / L hygromycin to screen for positive clones. After sequencing verification, the plasmid was extracted to obtain the pMDC83-MtMYB1 plant overexpression vector ( figure 2 ), pMDC83-MtMYB1 was transformed into Agrobacterium tumefaciens strain EHA105 by freeze-thaw method. pMDC83-MtMYB1 was transformed into Arabidopsis thaliana by Agrobacterium strain EHA105, cultured on MS medium containing 50mg / L hygromycin, and the transgenic plants with hygromycin resistance were obtained through preliminary screening.

[0043] Extract the genomic DNA of transgenic Arabidopsis thaliana with hygromyc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a medicago truncatula MYB transcription factor MtMYB1. According to the invention, a gene MtMYB1 for regulating and controlling development, flowering phase andgrowth period of floral organs and changing a plant type is colonized from medicago truncatula flower, and the sequence of the gene MtMYB1 is SEQ ID NO.1. The analysis of mRNA (messenger Ribonucleic Acid) expression of the gene shows that the MtMYB1 is expressed in flower tissues with strong advantages; phenotypic change of arabidopsis thaliana for further over-expression of the MtMYB1 shows thatthe MtMYB1 has an important regulation and control effect on the development, the flowering phase and the growth period of the floral organs and the plant type. The invention discloses the applicationof the gene in genetic engineering of morphology, the flowering phase and the growth period of the floral organs as well as plant type transformation.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and relates to the application of MYB transcription factor MtMYB1 derived from Medicago truncatula, which is highly expressed in flowers and related to the morphological development of floral organs, flowering period and growth extension, and the number of cauline leaves of plants, Application of the MYB transcription factor MtMYB1 related to the number of collaterals in plant reproductive organs, flowering and growth stages, and plant type modification. Background technique [0002] Medicago truncatula (Medicago truncatula G.), also known as truncated alfalfa or truncated alfalfa, belongs to the annual plant of the genus Medicago in the family Fabaceae, and is also a model plant for legume research. With the completion of genome sequencing and annotation of gene-enriched regions of Medicago truncatula, reverse genetics has gradually become an effective method for gene function research. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/20
CPCC07K14/415C12N15/8261C12N15/827
Inventor 黄方阚贵珍杨慧张珍珍喻德跃
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More