PCR detection method of enterohemorrhagic escherichia coli in vegetables
A technology for Escherichia coli and enterohemorrhagic, which is applied in the field of food hygiene detection, can solve the problems of cross-reaction, long time, low sensitivity, etc., and achieve the goal of improving work level, good sensitivity and specificity, and perfect detection technology Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. Primers and probes used:
[0040] Select enterohemorrhagic Escherichia coli O 157 :H 7 rfbE Design and synthesize microdroplet digital PCR-specific amplification primers and probes for genes;
[0041] Detection of Enterohemorrhagic Escherichia coli O by Droplet Digital PCR 157: H 7 The primer and probe base sequences include:
[0042] rfbE Gene upstream primer: CTGTAAGTAATGGAACGGTTG;
[0043] rfbE Gene downstream primer: GTCAGTGTTGGAACAATAACT;
[0044] with fluorescent dyes rfbE Gene probe: ATCTCCTTCCGATATACCTAACGC;
[0045] The 5' end of the fluorescent dye is labeled with FAM, and the 3' end is labeled with TAMRA.
[0046] 2. Sample preparation, enrichment culture, and bacterial template DNA extraction were performed as follows:
[0047] In accordance with the relevant provisions of GB 4789.1 "General Principles of Food Microbiological Inspection of National Food Safety Standards", under sterile conditions, the common cabbage vegetables, taproot vegetab...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com