Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rapid screening kit for fragile X syndrome

A kit and primer combination technology, applied in the field of rapid screening of the CGG repeat sequence of the fragile X syndrome causative gene FMR1, can solve the problems of high cost, expensive equipment, long cycle, etc., and achieve low price and small sample size Effect

Inactive Publication Date: 2018-07-20
杭州方夏生物科技有限公司
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the difficulty of high GC sequence amplification, it is difficult for ordinary laboratories to perform fragile X detection, which is prone to misdiagnosis or missed diagnosis
Although some international companies have launched PCR-based detection kits at present, the wide range of kits is limited by the relatively expensive instruments required for detection, the high price of kits, and the complicated results of Fragile X detection that require experienced testing personnel to analyze. application
The Southern blot analysis method can determine the number of large CGG repeat sequences and assess the degree of methylation of the FMR1 gene, but one experiment requires 10 micrograms of high-quality DNA, and mutation carriers or chimeras before the number of amplifications may be missed or Misdiagnosis, unable to accurately read the size of CGG, and there are problems such as complex experimental technology, high cost, and long cycle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid screening kit for fragile X syndrome
  • Rapid screening kit for fragile X syndrome
  • Rapid screening kit for fragile X syndrome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Preparation of Fragile X Syndrome Rapid Screening Kit

[0030] 1. Primer design

[0031] Design a pair of PCR system I specific upstream primers FMR1-F1 and downstream primers FMR1-R1 within 200 bp of the upstream 5' end and downstream 3' end of the CGG repeat sequence of the FMR1 gene to amplify the target genome including the CGG repeat region, 5' flanking region and 3' flanking region. The 5' flanking region is 141bp, the 3' flanking region is 80bp, and the length of the amplified fragment is (221+3xn)bp, where n represents the number of CGG repeats. The formula for calculating the CGG repeat number is: CGG repeat number=(PCR product length-221) / 3.

[0032]In the CGG repeat region of the FMR1 gene, the upstream primer FMR1-CGG was designed to specifically bind to the CGG repeat sequence 7 , and added human genome irrelevant sequence CAGGAAACAGCTATGACCGTGCCG at its 5' end, primer FMR1-T1 sequence is the added sequence CAGGAAACAGCTATGACCGTGCCG; design spe...

Embodiment 2

[0039] Example 2: Female premutation

[0040] Use a commercially available genomic DNA extraction kit to extract peripheral blood genomic DNA from female samples, with a concentration of at least 50 ng / μL, a 260 / 230 value greater than 2.0, and a 260 / 280 value greater than 1.8.

[0041] PCR system I reaction system prepared using the kit in Example 1: prepare 20 μL PCR system in a 200 μL PCR thin-walled tube.

[0042] The PCR reaction system is as follows:

[0043]

[0044]

[0045] The sequences of the primers FMR1-F1 and FMR1-R1 are respectively: SEQ ID NO: 1 and SEQ ID NO: 2.

[0046] PCR amplification program: 98°C pre-denaturation for 10 minutes; 97°C for 35 seconds → 64°C for 35 seconds → 68°C for 4 minutes, 40 cycles; 68°C for 10 minutes.

[0047] After the reaction, take 1 μL of PCR product, mix with 10 μL deionized formamide and 1 μL DNA internal standard ROX-500, denature at 95°C for 5 minutes, and cool on ice. The mixture was subjected to capillary electroph...

Embodiment 3

[0049] Example 3: Female Unimodal

[0050] According to embodiment 2, use PCR system I to detect the women who are unimodal, and carry out embodiment 3 to detect.

[0051] Use the kit in Example 1 to prepare the PCR system II reaction system: prepare 20 μL of the PCR system in a 200 μL PCR thin-walled tube.

[0052] The PCR reaction system is as follows:

[0053]

[0054] The primer FMR1-F2 sequence is: SEQ ID NO: 6; the FMR1-R2 sequence is: SEQ ID NO: 5; FMR1-CGG 7 The sequence is SEQ ID NO: 4; FMR1-CCG 7 The sequence is SEQ ID NO: 8; the sequence of FMR1-T1 is SEQ ID NO: 3; the sequence of FMR1-T2 is SEQ ID NO: 7.

[0055] PCR amplification program: 98°C pre-denaturation for 10 minutes; 97°C for 45 seconds → 60°C for 45 seconds → 68°C for 8 minutes, 10 cycles; 68°C for 10 minutes.

[0056] After the reaction, take 1 μL of the PCR product, mix it with 10 μL of deionized formamide and 1 μL of DNA internal standard ROX-500, denature at 95°C for 5 minutes, and cool on ice...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection method for rapidly screening the CGG repeat sequence of a fragile X syndrome site FMR1 gene, and a kit thereof. The kit includes DNA polymerase, a reaction solution,an enhancer, dNTPs, a specific primer and a standard control. The CGG repeat sequence amplified with a high-thermal stability DNA polymerase through a high-CG PCR system undergoes fluorescence scanning, and the obtained fluorescence scanning result is compared with the fluorescence scanning result of the standard control to accurately determine the interval of the CGG repeat sequence of a sampleto be detected. The kit is used for the rapid screening of the CGG repeat number of the fragile X syndrome site FMR1 of a large amount of samples of males and females in order to determine whether therepeat number belongs to a normal interval, a transitional interval or a fragile X premutation or full mutation range and screen carriers of the fragile X-causing gene, and the method can be appliedto fragile X genetic detection, prenatal diagnosis and pre-implantation diagnosis. The kit has the characteristics of fastness, high flux, low sample number and low price.

Description

technical field [0001] The invention relates to the field of molecular biology diagnosis, in particular to a method and a kit for rapidly screening the CGG repeat sequence of the fragile X syndrome pathogenic gene FMR1. Background technique [0002] Fragile X Syndrome (FXS) is the most common single gene disease causing hereditary mental retardation and autism spectrum disorder, and more than 95% of Fragile X syndrome patients are due to the CGG repeat sequence in the 5' non-coding region of the FMR1 gene Amplification results in silencing of FMRP expression. CGG repeats are highly polymorphic in the population, the normal number of repeats is 6-44, the expression of FMR1 gene is normal, and there is no obvious clinical manifestation. The number of repeats in the middle is 45-54, and the progeny can be expanded into a premutation without obvious clinical manifestations. Individuals whose CGG repeat number is mutated to 55-200 are called premutation carriers (Premutation, P...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 金赟懿
Owner 杭州方夏生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com