Rapid screening kit for fragile X syndrome
A kit and primer combination technology, applied in the field of rapid screening of the CGG repeat sequence of the fragile X syndrome causative gene FMR1, can solve the problems of high cost, expensive equipment, long cycle, etc., and achieve low price and small sample size Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: Preparation of Fragile X Syndrome Rapid Screening Kit
[0030] 1. Primer design
[0031] Design a pair of PCR system I specific upstream primers FMR1-F1 and downstream primers FMR1-R1 within 200 bp of the upstream 5' end and downstream 3' end of the CGG repeat sequence of the FMR1 gene to amplify the target genome including the CGG repeat region, 5' flanking region and 3' flanking region. The 5' flanking region is 141bp, the 3' flanking region is 80bp, and the length of the amplified fragment is (221+3xn)bp, where n represents the number of CGG repeats. The formula for calculating the CGG repeat number is: CGG repeat number=(PCR product length-221) / 3.
[0032]In the CGG repeat region of the FMR1 gene, the upstream primer FMR1-CGG was designed to specifically bind to the CGG repeat sequence 7 , and added human genome irrelevant sequence CAGGAAACAGCTATGACCGTGCCG at its 5' end, primer FMR1-T1 sequence is the added sequence CAGGAAACAGCTATGACCGTGCCG; design spe...
Embodiment 2
[0039] Example 2: Female premutation
[0040] Use a commercially available genomic DNA extraction kit to extract peripheral blood genomic DNA from female samples, with a concentration of at least 50 ng / μL, a 260 / 230 value greater than 2.0, and a 260 / 280 value greater than 1.8.
[0041] PCR system I reaction system prepared using the kit in Example 1: prepare 20 μL PCR system in a 200 μL PCR thin-walled tube.
[0042] The PCR reaction system is as follows:
[0043]
[0044]
[0045] The sequences of the primers FMR1-F1 and FMR1-R1 are respectively: SEQ ID NO: 1 and SEQ ID NO: 2.
[0046] PCR amplification program: 98°C pre-denaturation for 10 minutes; 97°C for 35 seconds → 64°C for 35 seconds → 68°C for 4 minutes, 40 cycles; 68°C for 10 minutes.
[0047] After the reaction, take 1 μL of PCR product, mix with 10 μL deionized formamide and 1 μL DNA internal standard ROX-500, denature at 95°C for 5 minutes, and cool on ice. The mixture was subjected to capillary electroph...
Embodiment 3
[0049] Example 3: Female Unimodal
[0050] According to embodiment 2, use PCR system I to detect the women who are unimodal, and carry out embodiment 3 to detect.
[0051] Use the kit in Example 1 to prepare the PCR system II reaction system: prepare 20 μL of the PCR system in a 200 μL PCR thin-walled tube.
[0052] The PCR reaction system is as follows:
[0053]
[0054] The primer FMR1-F2 sequence is: SEQ ID NO: 6; the FMR1-R2 sequence is: SEQ ID NO: 5; FMR1-CGG 7 The sequence is SEQ ID NO: 4; FMR1-CCG 7 The sequence is SEQ ID NO: 8; the sequence of FMR1-T1 is SEQ ID NO: 3; the sequence of FMR1-T2 is SEQ ID NO: 7.
[0055] PCR amplification program: 98°C pre-denaturation for 10 minutes; 97°C for 45 seconds → 60°C for 45 seconds → 68°C for 8 minutes, 10 cycles; 68°C for 10 minutes.
[0056] After the reaction, take 1 μL of the PCR product, mix it with 10 μL of deionized formamide and 1 μL of DNA internal standard ROX-500, denature at 95°C for 5 minutes, and cool on ice...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


