Larimichthys crocea genetic sex related SNP (Single Nucleotide Polymorphism) marker and primer and application

A large yellow croaker and labeling technology, applied in the field of SNP, can solve the problems of inability to repair mismatch, template not amplified or low amplification efficiency, lack of 3'-5' exonuclease activity, etc., to achieve the effect of reducing damage

Active Publication Date: 2018-08-21
JIMEI UNIV
View PDF5 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The basic principle is that ordinary Taq DNA polymerase lacks 3'-5' exonuclease activity, and cannot repair the mismatch of a single base at the 3' end of the DNA primer. When the gene sequence is complementary, the DNA template can be amplified. On the contrary, if the 3' terminal nucleotide is mismatched with the SNP allele sequence, the template will not be amplified or the amplification efficiency will be low.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Larimichthys crocea genetic sex related SNP (Single Nucleotide Polymorphism) marker and primer and application
  • Larimichthys crocea genetic sex related SNP (Single Nucleotide Polymorphism) marker and primer and application
  • Larimichthys crocea genetic sex related SNP (Single Nucleotide Polymorphism) marker and primer and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Discovery and verification of sex-specific SNP markers in large yellow croaker

[0037] Large yellow croaker is a diploid organism with XX / XY sex determination system, female is XX and male is XY. Through the comparative analysis of the whole genome resequencing data of 6 groups of male and female large yellow croakers, the results show that the sequences from male fish are in figure 1 There are two bases of T or C on the SNP site shown, and there is no SNP polymorphism at this site in the sequence from the female fish, and the base at this site is C in all sequences. The reads containing this site in the whole genome resequencing data of 6 groups of male and female large yellow croakers were counted, and the results are shown in Table 1.

[0038] Table 1 Genotypes of one SNP locus in linkage group No. 9 of 6 resequencing samples of large yellow croaker

[0039]

[0040] Note: The 6 resequencing samples of large yellow croaker were mixed samples of femal...

Embodiment 2

[0042] Example 2, identification and identification of the genetic sex of large yellow croaker

[0043] The technical solution of this patent will be described in further detail below in conjunction with specific embodiments.

[0044] 1) Design of primers: Three primers LYC-SSS1F, LYC-SSS1R and LYC-SSS1FT were respectively designed according to the genome sequence (SNP) difference between female and male large yellow croaker disclosed in the present invention. Among them, the primers LYC-SSS1F and LYC-SSS1R are respectively on both sides of the SNP difference site, and the 3' terminal base of LYC-SSS1FT is consistent with the base of the SNP site on the Y chromosome. see figure 1 .

[0045] LYC-SSS1F:5' ATCTGTCAACCACTGTATCATCTG 3' SEQ ID NO:2;

[0046] LYC-SSS1R: 5' GGATGGCGTTTGGCTGAG 3' SEQ ID NO: 3;

[0047] LYC-SSS1FT:5' CATCCCCAGACCTCCACT 3' SEQ ID NO:4.

[0048] 2) Genomic DNA extraction: Randomly cut part of the fin rays of 48 large yellow croakers to be tested, put...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a larimichthys crocea genetic sex related SNP (Single Nucleotide Polymorphism) marker and a primer and the application. The larimichthys crocea genetic sex related SNP marker is the sequence shown as in SEQ ID NO:1, and the 201th basic group from the 5' end is T or C. The individual is female larimichthys crocea when the SNP marker is CC genotype, and the individual is malelarimichthys crocea when the SNP marker is CT genotype. By identifying the molecular marker, the SNP marker has the characteristic of rapidly, conveniently, accurately identifying the genetic sex oflarimichthys crocea, moreover, the larimichthys crocea genetic sex related SNP marker also lays foundations for successfully carrying out the work of sex control and breeding of larimichthys crocea, developing monosex cultivation, developing selective breeding of the genome of the larimichthys crocea, and studying the sex determination molecule mechanism.

Description

technical field [0001] The present invention relates to the field of SNPs, in particular to a genetic sex-related SNP marker of large yellow croaker and its primers and applications Background technique [0002] In the field of life science research, gender research has always been a hot topic, attracting the attention of many researchers. Fish is in the position of connecting the past and the future in the evolution of animals, and the number of species is abundant. Similar to most vertebrates, many fishes are dioecious and sexually dimorphic, that is, they show significant differences between males and females in morphology and physiology. Moreover, important economic traits such as individual growth and economic value of some fish species are closely related to sex. Therefore, the development of single-sex breeding and culture techniques for these fishes has great significance in the fish farming industry. Although many fishes have sexual dimorphism in growth, there is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6879C12N15/11
CPCC12Q1/6879C12Q2600/156
Inventor 王志勇林晓煜肖世俊
Owner JIMEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap