Cucurbita pepo TUA gene and application thereof
An American pumpkin and gene technology, which is applied in the field of molecular biology to achieve the effects of improving detection efficiency, improving stability and improving reliability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 Obtaining of internal reference genes
[0020] According to the results of Illumina high-throughput deep sequencing of the American pumpkin fruit transcriptome by our research group, the full-length TUA gene was screened, and on this basis, cDNA open reading frame (ORF) primers were designed for verification ( figure 1 ). Specifically, the pair of primers: forward primer 5'-: ATGAGAGAGTGCATTTCAATCC -3', reverse primer 5'-CTGGCATATCATCATGTTCA -3'.
[0021] PCR reaction system: The total volume of the reaction system is 25 μL, containing 25 ng template, 0.4 μmol / L forward primer, 0.4 μmol / L reverse primer, 0.15 mmol / L dNTP, 1 U Taq DNA polymerase, 1.5 mmol / L MgCl 2 2.5 μL of 10×PCR buffer, and the remaining components are sterilized ultrapure water.
[0022] The PCR reaction program was: pre-denaturation at 94°C for 3 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 60 s; finally, extension at 72°C for 7 ...
Embodiment 2
[0023] Example 2 Real-time fluorescent quantitative PCR design and routine PCR detection
[0024] Based on the nucleotide sequence of the American pumpkin internal reference gene TUA obtained in Example 1, and following the principles of real-time fluorescent quantitative PCR primer design, a pair of fluorescent quantitative specific primers were designed. The amplified fragment was 180 bp. The specific primers are the real-time fluorescent quantitative PCR primers (as shown in SEQ ID NO: 2, 3): forward primer 5'-TTCTCCCGAATTGACCACAA-3', reverse primer 5'-TCCTTCATCGTCCTCACCCT-3'.
[0025] Extract the total RNA of American squash, and synthesize the first strand of cDNA according to the method of PrimeScriptTM 1st Strand cDNA Synthesis Kit, that is, reverse transcribe the RNA into cDNA; then use the obtained cDNA as a template and real-time fluorescent quantitative PCR primers as primer pairs for PCR Amplification, and the reaction system and reaction procedure of PCR amplifica...
Embodiment 3
[0029] Example 3 Real-time fluorescent quantitative PCR primer verification
[0030] Extract the total RNA of American squash, and synthesize the first strand of cDNA according to the method of PrimeScriptTM 1st Strand cDNA Synthesis Kit, that is, reverse transcribe the RNA into cDNA; then use the obtained cDNA as a template, follow the instructions of Power SYBR® Green PCR Master Mix in ABI7500 The PCR reaction was carried out on the real-time quantitative PCR instrument, and the reaction system and reaction procedure of the PCR reaction were as follows:
[0031] The reaction system is: the total volume of the reaction system is 25 μL, 12.5 μL Power SYBR® Green PCR MasterMix, 1 μL template, 0.5 μL of the forward primer of the real-time fluorescence quantitative PCR primer in Example 2 (concentration is 10 μmol / L), implement The reverse primer of the real-time fluorescent quantitative PCR primer in Example 2 was 0.5 μL (concentration: 10 μmol / L), and distilled water was added ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



