Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cucurbita pepo TUA gene and application thereof

An American pumpkin and gene technology, which is applied in the field of molecular biology to achieve the effects of improving detection efficiency, improving stability and improving reliability

Inactive Publication Date: 2018-09-04
CROP RES INST OF FUJIAN ACAD OF AGRI SCI
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the cloning of the α-tubulin (TUA) gene of American squash and its use as an internal reference gene of American squash.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cucurbita pepo TUA gene and application thereof
  • Cucurbita pepo TUA gene and application thereof
  • Cucurbita pepo TUA gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Obtaining of internal reference genes

[0020] According to the results of Illumina high-throughput deep sequencing of the American pumpkin fruit transcriptome by our research group, the full-length TUA gene was screened, and on this basis, cDNA open reading frame (ORF) primers were designed for verification ( figure 1 ). Specifically, the pair of primers: forward primer 5'-: ATGAGAGAGTGCATTTCAATCC -3', reverse primer 5'-CTGGCATATCATCATGTTCA -3'.

[0021] PCR reaction system: The total volume of the reaction system is 25 μL, containing 25 ng template, 0.4 μmol / L forward primer, 0.4 μmol / L reverse primer, 0.15 mmol / L dNTP, 1 U Taq DNA polymerase, 1.5 mmol / L MgCl 2 2.5 μL of 10×PCR buffer, and the remaining components are sterilized ultrapure water.

[0022] The PCR reaction program was: pre-denaturation at 94°C for 3 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 60 s; finally, extension at 72°C for 7 ...

Embodiment 2

[0023] Example 2 Real-time fluorescent quantitative PCR design and routine PCR detection

[0024] Based on the nucleotide sequence of the American pumpkin internal reference gene TUA obtained in Example 1, and following the principles of real-time fluorescent quantitative PCR primer design, a pair of fluorescent quantitative specific primers were designed. The amplified fragment was 180 bp. The specific primers are the real-time fluorescent quantitative PCR primers (as shown in SEQ ID NO: 2, 3): forward primer 5'-TTCTCCCGAATTGACCACAA-3', reverse primer 5'-TCCTTCATCGTCCTCACCCT-3'.

[0025] Extract the total RNA of American squash, and synthesize the first strand of cDNA according to the method of PrimeScriptTM 1st Strand cDNA Synthesis Kit, that is, reverse transcribe the RNA into cDNA; then use the obtained cDNA as a template and real-time fluorescent quantitative PCR primers as primer pairs for PCR Amplification, and the reaction system and reaction procedure of PCR amplifica...

Embodiment 3

[0029] Example 3 Real-time fluorescent quantitative PCR primer verification

[0030] Extract the total RNA of American squash, and synthesize the first strand of cDNA according to the method of PrimeScriptTM 1st Strand cDNA Synthesis Kit, that is, reverse transcribe the RNA into cDNA; then use the obtained cDNA as a template, follow the instructions of Power SYBR® Green PCR Master Mix in ABI7500 The PCR reaction was carried out on the real-time quantitative PCR instrument, and the reaction system and reaction procedure of the PCR reaction were as follows:

[0031] The reaction system is: the total volume of the reaction system is 25 μL, 12.5 μL Power SYBR® Green PCR MasterMix, 1 μL template, 0.5 μL of the forward primer of the real-time fluorescence quantitative PCR primer in Example 2 (concentration is 10 μmol / L), implement The reverse primer of the real-time fluorescent quantitative PCR primer in Example 2 was 0.5 μL (concentration: 10 μmol / L), and distilled water was added ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology and provides cucurbita pepo alpha-tubulin (TUA) gene and application thereof as reference gene. A nucleotide sequence of the cucurbita pepo TUAgene is shown as SEQ ID NO.1, and a cucurbita pepo real-time fluorescent quantitative PCR primer designed according to the gene sequence is shown as SEQ ID NO.2 and SEQ ID NO.3. The designed real-timefluorescent quantitative PCR primer disclosed by the invention has the advantages of strong specificity and very high stability, reliability and repeatability. Researches show that the cucurbita pepoalpha-tubulin can be stably expressed in different tissues, in different periods and under varieties of abiotic stress conditions, so that the cucurbita pepo alpha-tubulin is suitable for serving asthe reference gene in cucurbita pepo gene expression researches.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and specifically relates to an α-tubulin (TUA) gene which can be stably expressed in different tissues, different periods and various abiotic stress conditions of American squash and its application as an internal reference gene. Background technique [0002] Pumpkin ( Cucurbita pepo L. ), also known as zucchini, is an annual herb of Cucurbitaceae (Cucurbitaceae) and is native to southern America. It was cultivated in my country in the middle of the nineteenth century. American pumpkin is delicious, nutritious, and has good medical and health functions. It is deeply loved by the public. It has been planted on a large scale in my country and has become the second largest melon vegetable after cucumber. With the continuous deepening and development of its molecular biology research, gene expression analysis is gradually being applied to reveal the gene regulation mechanism of squash. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/11C12Q1/6851
CPCC07K14/415C12Q1/6851C12Q2545/101C12Q2531/113
Inventor 朱海生李永平刘建汀陈敏氡王彬温文旭林珲张前荣温庆放
Owner CROP RES INST OF FUJIAN ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com