Supercharge Your Innovation With Domain-Expert AI Agents!

Engineering bacterium for poly-gamma-glutamic acid with high yield as well as construction method and application thereof

A technology of engineering bacteria and glutamic acid, applied in the field of genetic engineering and microbial fermentation, to achieve the effect of increasing the output of γ-PGA, increasing the yield, and increasing the modification effect

Active Publication Date: 2018-09-28
HUBEI UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still no research on the transmembrane transport process of γ-PGA and its application in promoting the efficient synthesis of γ-PGA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterium for poly-gamma-glutamic acid with high yield as well as construction method and application thereof
  • Engineering bacterium for poly-gamma-glutamic acid with high yield as well as construction method and application thereof
  • Engineering bacterium for poly-gamma-glutamic acid with high yield as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Construction of pHY-dltB expression plasmid

[0038] According to the gene sequence of the dltB gene in the bacillus licheniformis WX-02 genome DNA sequence, design the upstream primer (dltB-F) and the downstream primer (dltB-R) of the dltB gene; And take the genome DNA of bacillus licheniformis WX-02 as Template, obtained dltB gene fragment (1158bp) by PCR amplification;

[0039] Among them, the sequences of dltB-F and dltB-R are:

[0040] dltB-F:TAGGTAAGAGAGGAATGTATCACATGACACCCTATGGTTCATTTCdltB-R:GAAATCCGTCCTCTCTGCCTTTTTAGTGTATTAGTTCCCTGAG

[0041] Using the genomic DNA of Bacillus subtilis 168 as a template, the P43 promoter was amplified by PCR (primers used were P43-F and P43-R); using the genomic DNA of Bacillus licheniformis WX-02 as a template, amylase was amplified by PCR terminator (primers used are TamyL-F and TamyL-R), and then the promoter, gene of interest and terminator are ligated together by SOE-PCR (primers used are P43-F and TamyL-R) to fo...

Embodiment 2

[0050] Example 2 Construction of Bacillus licheniformis WX-02 / pHY-dltB

[0051] The free expression vector pHY-dltB was transferred into Bacillus licheniformis WX-02 (disclosed in Chinese patent CN106497857A), and under the condition of 37°C, the medium containing tetracycline resistance was screened to obtain transformants. Plasmids were verified by colony PCR (primers used were: pHY-F and pHY-R). The PCR verification result of the positive transformant is an electrophoretic band at 2230bp, combined with the sequence determination results, it is proved that the free expression vector pHY-dltB was successfully transferred into Bacillus licheniformis WX-02, Bacillus licheniformis WX-02 / pHY-dltB) The construction was successful, and the control strain WX-02 / pHY300 was to transform the plasmid pHY300 into WX-02, and the operation steps were the same as those for the construction of WX-02 / pHY-dltB.

Embodiment 3

[0052] Example 3 Fermentation test of Bacillus licheniformis WX-02 / pHY-dltB to produce γ-PGA

[0053] 1. Seed culture

[0054] Activate Bacillus licheniformis WX-02 / pHY-dltB and WX-02 / pHY300, that is, inoculate 1% by volume from a glycerol tube into 5mL LB medium, culture at 180-300r / min at 37°C for 10 ~14 hours, then inoculate the bacterium solution after the activation of the strain on the medium for seed fermentation with a volume percentage of 1% inoculum, and then cultivate it at 180-300r / min and 37°C for 10-12 hours to obtain the seed-cultured bacteria liquid.

[0055] 2. Production of γ-PGA by fermentation

[0056] In order to better analyze the effect of dltB expression on the production of γ-PGA by Bacillus licheniformis fermentation, fermentation experiments were carried out using the media shown in Table 1, respectively.

[0057] The formula of table 1 fermentation medium

[0058]

[0059]

[0060] Other ingredients in the 18 media are: 10g / L sodium citrat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an engineering bacterium for poly-gamma-glutamic acid with high yield as well as a construction method and application thereof. The engineering bacterium for poly-gamma-glutamicacid with high yield disclosed by the invention is a recombinant microorganism for enhancing expression of dltB genes, wherein the operation of enhancing expression is to introduce one or more copieddltB genes and / or replace an expression element of the dltB genes with an expression element with high activity. The yield of the gamma-glutamic acid produced by utilizing the engineering bacterium for fermentation obtained by improving the expression of the dltB genes is improved by 20% or higher. The engineering bacterium disclosed by the invention can achieve the effects of improving the yieldof the poly-gamma-glutamic acid produced by fermentation and reducing the production cost, and has good market application value.

Description

technical field [0001] The invention relates to the field of genetic engineering and microbial fermentation, in particular to an engineering bacterium with high yield of poly-γ-glutamic acid and its construction method and application. Background technique [0002] Poly-γ-glutamic acid (γ-PGA) is a kind of natural anionic biopolymer, mainly composed of L-glutamic acid and D-glutamic acid monomers through γ-amide bonded together. The γ-PGA molecule has a large number of free negatively charged carboxyl groups, which makes it capable of combining with a large number of metal cations and has hydrophilic properties. These structural characteristics make γ-PGA have good water solubility, strong adsorption capacity, biodegradability, non-toxic to human body and environment, etc., and have a wide range of applications in the fields of medicine, food, cosmetics, environmental protection and agriculture. [0003] There are mainly two sources of L-glutamic acid as the synthetic prec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P13/02C12R1/10
CPCC12N9/93C12P13/02C12Y603/02004
Inventor 陈守文何鹏辉蔡冬波陈耀中王世依莫非马昕
Owner HUBEI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com