Primer probe combination for detection of EGFR gene mutation and application of same
A primer probe and probe technology, applied in the field of molecular biology, can solve the problems of decreased wild-type amplification efficiency, insufficient detection accuracy and specificity of detection reagents, etc., to increase sensitivity and specificity, inhibit amplification, The effect of improving accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0135] The assembly of embodiment 1 kit
[0136] The design of the primer probe combination, the specific sequence is shown in Table 2 below:
[0137] Table 2
[0138]
[0139]
[0140]
[0141] Wherein, the mismatch rate of the EGFR gene mutation detection specific primer pair is 24%, and the base overlapping sequence between the amplification blocking probe and the downstream primer in the EGFR gene mutation detection specific primer pair is 8 bp;
[0142] Negative quality control: the negative quality control is TE buffer;
[0143] Positive quality control product: EGFR gene mutant plasmid, the nucleotide sequence of the mutant plasmid is shown in SEQ ID NO.55, and the specific sequence is as follows:
[0144] ACTTTATAACAGGCTTTACAAGCTTGAGATTCTTTTATCTAAATAATCAGTGTGATTCGTGGAGCCCAACAGCTGCAGGGCTGCGGGGGCGTCACAGCCCCCAGCAATATCAGCCTTAGGTGCGGCTCCACAGCCCCAGTGTCCCTCACCTTCGGGGTGCATCGCTGGTAACATCCACCCAGATCACTGGGCAGCATGTGGCACCATCTCACAATTGCCAGTTAACGTCTTCCTTCTCTCTCTGTCATAGGGACTCT...
Embodiment 2
[0147] Embodiment 2 EGFR gene mutation detection
[0148] Adopt the kit in embodiment 1 to carry out EGFR gene mutation detection, comprise the steps:
[0149] (1) Sample DNA extraction:
[0150] Paraffin-embedded pathological tissue sections of non-small cell lung cancer (sample 1) and colorectal cancer (sample 2) were taken, and the paraffin-embedded tissue section samples were extracted using QIAamp DNA FFPE Tissue Kit (Cat.no.56404) of QIAGEN. To extract DNA, the concentration and purity should be measured with a UV spectrophotometer. The DNA OD260 / OD280 value should be between 1.8 and 2.0, and the concentration should be between 3.3 and 13.2 ng / ul;
[0151] (2) preparation system, the specific system composition is as shown in Table 3 below:
[0152] table 3
[0153]
[0154]
[0155]
[0156] Add the DNA sample extracted in step (1) to the above reaction system, the DNA sample volume is less than 15ng, add it to the corresponding PCR reaction well, seal the s...
Embodiment 3
[0185] Compared with Example 1-2, only the base overlapping sequence of the amplification blocking probe and the downstream primer in the EGFR gene mutation detection specific primer pair is 2bp, and other components and conditions are the same as those in Example 1-2 same.
[0186] The results showed that non-specific amplification occurred in the detection sample.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



