Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer probe combination for detection of EGFR gene mutation and application of same

A primer probe and probe technology, applied in the field of molecular biology, can solve the problems of decreased wild-type amplification efficiency, insufficient detection accuracy and specificity of detection reagents, etc., to increase sensitivity and specificity, inhibit amplification, The effect of improving accuracy

Active Publication Date: 2018-10-02
WUXI SHENRUI BIO PHARMA
View PDF8 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The primer set includes T790M primer pair, TaqMan-MGB probe, and wild-type downstream primers, in which the upstream primer of T790M additionally introduces mismatched bases, which reduces the efficiency of wild-type amplification
However, the detection accuracy and specificity of the detection reagents of the existing method ARMS-PCR are not high enough

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probe combination for detection of EGFR gene mutation and application of same
  • Primer probe combination for detection of EGFR gene mutation and application of same
  • Primer probe combination for detection of EGFR gene mutation and application of same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0135] The assembly of embodiment 1 kit

[0136] The design of the primer probe combination, the specific sequence is shown in Table 2 below:

[0137] Table 2

[0138]

[0139]

[0140]

[0141] Wherein, the mismatch rate of the EGFR gene mutation detection specific primer pair is 24%, and the base overlapping sequence between the amplification blocking probe and the downstream primer in the EGFR gene mutation detection specific primer pair is 8 bp;

[0142] Negative quality control: the negative quality control is TE buffer;

[0143] Positive quality control product: EGFR gene mutant plasmid, the nucleotide sequence of the mutant plasmid is shown in SEQ ID NO.55, and the specific sequence is as follows:

[0144] ACTTTATAACAGGCTTTACAAGCTTGAGATTCTTTTATCTAAATAATCAGTGTGATTCGTGGAGCCCAACAGCTGCAGGGCTGCGGGGGCGTCACAGCCCCCAGCAATATCAGCCTTAGGTGCGGCTCCACAGCCCCAGTGTCCCTCACCTTCGGGGTGCATCGCTGGTAACATCCACCCAGATCACTGGGCAGCATGTGGCACCATCTCACAATTGCCAGTTAACGTCTTCCTTCTCTCTCTGTCATAGGGACTCT...

Embodiment 2

[0147] Embodiment 2 EGFR gene mutation detection

[0148] Adopt the kit in embodiment 1 to carry out EGFR gene mutation detection, comprise the steps:

[0149] (1) Sample DNA extraction:

[0150] Paraffin-embedded pathological tissue sections of non-small cell lung cancer (sample 1) and colorectal cancer (sample 2) were taken, and the paraffin-embedded tissue section samples were extracted using QIAamp DNA FFPE Tissue Kit (Cat.no.56404) of QIAGEN. To extract DNA, the concentration and purity should be measured with a UV spectrophotometer. The DNA OD260 / OD280 value should be between 1.8 and 2.0, and the concentration should be between 3.3 and 13.2 ng / ul;

[0151] (2) preparation system, the specific system composition is as shown in Table 3 below:

[0152] table 3

[0153]

[0154]

[0155]

[0156] Add the DNA sample extracted in step (1) to the above reaction system, the DNA sample volume is less than 15ng, add it to the corresponding PCR reaction well, seal the s...

Embodiment 3

[0185] Compared with Example 1-2, only the base overlapping sequence of the amplification blocking probe and the downstream primer in the EGFR gene mutation detection specific primer pair is 2bp, and other components and conditions are the same as those in Example 1-2 same.

[0186] The results showed that non-specific amplification occurred in the detection sample.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection product for gene mutation and particularly relates to a primer probe combination for detection of EGFR gene mutation and an application of the same. The primer probe combination includes a detection primer probe, which includes an EGFR gene mutation detection specific primer pair, an EGFR gene specific probe, an amplification blocking probe, and an internal reference system, wherein the loci of mutation detection of the EGFR gene are the mutation loci of 18-21 exons. The primer probe combination has high specificity and sensitivity on the EGFR gene mutationand simple and quick operation. The detection result has great accuracy and repeatability. The primer probe combination can detect a tumor tissue sample and can help clinical treatment, so that the primer probe combination has important value.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a product for detecting gene mutation, in particular to a combination of primers and probes for detecting EGFR gene mutation and its application. Background technique [0002] Lung cancer and colorectal cancer are common malignant tumors in the world today, and have become the main cause of cancer death in most countries. Among them, non-small cell lung cancer (NSCLC) is the most common. At present, targeted therapy has become an important means of clinical treatment of non-small cell lung cancer (NSCLC) and colorectal cancer. A large number of research data show that EGFR gene mutations are mainly concentrated in the 18-2l exons of the tyrosine kinase coding domain (TKI), and these mutations are related to gefitinib drug responsiveness, and the reason may be that these mutations Change the structure of EGFR intracellular ATP binding region, improve the binding ability ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/156C12Q2600/166
Inventor 白静盛青松姚鲁帅
Owner WUXI SHENRUI BIO PHARMA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More