Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CPS1 report gene stem cell, and building method and application thereof

A technology of reporter gene and construction method, which is applied in the field of bioengineering, can solve the problems of low liver cell function, low overall cell function, and lack of intermediate cells, etc., and achieve the effect of high purity

Inactive Publication Date: 2018-10-16
ACADEMY OF MILITARY MEDICAL SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because the intermediate cells do not have the specific functions of hepatocytes or the function of hepatocytes is low, the overall function of the induced cells is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CPS1 report gene stem cell, and building method and application thereof
  • CPS1 report gene stem cell, and building method and application thereof
  • CPS1 report gene stem cell, and building method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1, design the single-stranded guide RNA (sgRNA) of carbamoyl phosphate synthetase 1 (CPS1) gene and backbone vector construction

[0053] 1) Design the single-stranded guide RNA (sgRNA) of the carbamoyl phosphate synthase 1 (CPS1) gene by using the sgRNA target design software on the website of MIT Zhang Feng Laboratory (URL: crispr.mit.edu) to identify the CPS1 gene (GenBank number: 1737 ), the target sequence of the CPS1 gene is: AGCTGTGCAGAAATCTCGCA (located at 4759-4778 bases from the 5' end of the CPS1 gene), and a cohesive end that can be digested with Bbs I is added to this sequence The nucleotides that form a pair, the specific sequence is as follows:

[0054] oligo1:5'- CACC AGCTGTGCAGAAATCTCGCA-3',

[0055] oligo2:5'- TTTG ACGCTCTAAAGACGTGTCGA-3';

[0056]The underlined sequence can be complementary to the end of Bbs I digestion. Oligo1 and Oligo 2 contain guide sequence sgRNA, which can form sgRNA with the backbone sequence contained in the to...

Embodiment 2

[0075] Example 2. Construction of the targeting vector pET32-CPSLR-tdTomato of the CPS1 gene

[0076] like figure 2 As shown, this embodiment takes the introduction of the fluorescent group tdTomato as an example to illustrate the construction process of the targeting vector pET32-CPSLR-tdTomato of the CPS1 gene. Include the following steps:

[0077] 1) Design primers for amplification of the CPS1 gene left arm insert (CPSL) and right arm insert (CPSR). The primer sequences are as follows (please provide the following primer sequences):

[0078] CPS1 Gene Left Arm Insert Segment (CPSL) Amplification Primers:

[0079] Forward primer (CPSL-F): 5'-GAAGATCTTTGTGTGAATCTTCAGGAATA-3'

[0080] Reverse primer (CPSL-R): 5'-CGGATATCTGCTGCTTTTCCAGCACTGT-3';

[0081] CPS1 Gene Right Arm Insert Segment (CPSR) Amplification Primers:

[0082] Forward primer (CPSR-F): 5'-ACGCGTCGACAGATGCAGACACCCCAGCC-3'

[0083] Reverse primer (CPSR-R): 5'-CCCAAGCTTGAAGTAATGAAAGTCTTGAC-3'.

[0084] 2) ...

Embodiment 3

[0121] Embodiment 3, construction CPS1-tdtomato reporter gene human embryonic stem cell

[0122]Mix pX458-sgCPS1 (the backbone carrier of the CPS1 gene) and pET32-CPSLR-2A-tdTomato (the targeting carrier of the CPS1 gene) at a ratio of 1:3 (mass ratio), and mix each 10 6 Human embryonic stem cells (hESCs) cells (purchased from WiCell Research Institute, NIH number WA09) were mixed with 2 μg of mixed plasmids, 1050V 30pulse electric shock twice (Life Technology Company), and the cells were resuspended in 2 mL containing 10 μM Rho-related protein kinase inhibitor 200 μg / mL G418 (Neomycin, Gibco Company, Cat. No. 10131035) was added after 24 hours for screening (screening criteria were G418 resistance And normal embryonic stem cell clone growth). After 15 days, 10 G418-resistant clones were obtained, and their genomic DNA was extracted, and oligonucleotides derived from the CPS1 DNA sequence and the tdtomato gene sequence were used as primers (sequence: 5'-GAAGATCT TTGTGTGAATCTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a carbamyl phosphate synthetase 1 report gene stem cell (CPS1 report gene stem cell), and a building method and application thereof. Experiments prove that by using the induction scheme obtained through CPS1 report gene human embryonic stem cell (hESCs) screening, the induced differentiation to effectively enhanced hepatocyte-like cells is realized. The CPS1 report gene stem cell can be applied to the screening of induction agents in a liver direction induction differentiation system; hepatocyte-like cells obtained through induction differentiation can be applied to liver medicine metabolism study and liver medicine toxicity evaluation; and wide application prospects are realized.

Description

technical field [0001] The invention belongs to a transgenic cell line in the field of bioengineering, in particular to a CPS1 reporter gene stem cell system and its construction method and application. Background technique [0002] The liver is the organ with the main metabolic function in the body. It has the functions of secreting albumin, synthesizing and storing glycogen, and removing toxic ammonia from the body. It is also the most important drug metabolism organ. Liver life activities mainly depend on hepatic parenchymal cells, which account for 65% of all liver cells and 70%-80% of the total liver volume. In 1969, Berry et al first invented the two-step perfusion method to separate primary hepatocytes (Berry et al. J Cell Biol. 1969, 43(3): 506-520.). With the development of molecular biology, cell biology, materials science and other disciplines, the methods of isolating hepatocytes are gradually improved and perfected. Currently, two-step perfusion combined with ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/66C12Q1/02
CPCC12N15/66C12N15/85G01N33/5008
Inventor 王韫芳王怡常乐
Owner ACADEMY OF MILITARY MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com