Unlock instant, AI-driven research and patent intelligence for your innovation.

CPS1 reporter gene human liver cell line, construction method hereof and applications thereof

A reporter gene and construction method technology, applied in the field of bioengineering, can solve the problems of hepatic cells with low function, complexity, and lack of intermediate state cells, and achieve the effect of high purity and broad application prospects

Inactive Publication Date: 2017-07-14
FIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because intermediate cells do not have the specific functions of hepatocytes or the function of hepatocytes is low, the overall function of the induced cells is low, and there are major defects in the evaluation of drug metabolism
[0005] At the same time, at present, end-point indicators (such as cell survival rate) are often used in drug evaluation, which makes the monitoring of drug action process complicated, and more settings need to be added to obtain relatively accurate results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CPS1 reporter gene human liver cell line, construction method hereof and applications thereof
  • CPS1 reporter gene human liver cell line, construction method hereof and applications thereof
  • CPS1 reporter gene human liver cell line, construction method hereof and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1, design the single-stranded guide RNA (sgRNA) of carbamoyl phosphate synthetase 1 (CPS1) gene and backbone vector construction

[0060] 1) Design the single-stranded guide RNA (sgRNA) of the carbamoyl phosphate synthase 1 (CPS1) gene by using the sgRNA target design software on the website of MIT Zhang Feng Laboratory (URL: crispr.mit.edu) to identify the CPS1 gene (GenBank number: 1737 ), the target sequence of the CPS1 gene is: AGCTGTGCAGAAATCTCGCA (located at 4759-4778 bases from the 5' end of the CPS1 gene), and a cohesive end that can be digested with Bbs I is added to this sequence The nucleotides that form a pair, the specific sequence is as follows:

[0061] oligo1:5'- CACC AGCTGTGCAGAAATCTCGCA-3',

[0062] oligo2:5'- TTTG ACGCTCTAAAGACGTGTCGA-3';

[0063] The underlined sequence can be complementary to the end of Bbs I digestion. Oligo1 and Oligo 2 contain guide sequence sgRNA, which can form sgRNA with the backbone sequence contained in the t...

Embodiment 2

[0079] Example 2. Construction of the targeting vector pET32-CPSLR-tdTomato of the CPS1 gene

[0080] Such as figure 2 As shown, the construction process of the targeting vector pET32-CPSLR-tdTomato of the CPS1 gene includes the following steps:

[0081] 1) Design primers for amplification of the CPS1 gene left arm insert (CPSL) and right arm insert (CPSR). The primer sequences are as follows (please provide the following primer sequences):

[0082] CPS1 Gene Left Arm Insert Segment (CPSL) Amplification Primers:

[0083] Forward primer (CPSL-F): 5'-GAAGATCTTTGTGTGAATCTTCAGGAATA-3'

[0084] Reverse primer (CPSL-R): 5'-CGGATATCTGCTGCTTTTCCAGCACTGT-3';

[0085] CPS1 Gene Right Arm Insert Segment (CPSR) Amplification Primers:

[0086] Forward primer (CPSR-F): 5'-ACGCGTCGACAGATGCAGACACCCCAGCC-3'

[0087] Reverse primer (CPSR-R): 5'-CCCAAGCTTGAAGTAATGAAAGTCTTGAC-3'.

[0088] 2) PCR amplification of CPS1 gene left arm insert (CPSL) and right arm insert (CPSR) PCR reaction syst...

Embodiment 3

[0120] Example 3, construction of CPS1-tdtomato reporter human liver cancer cell line (HepG2) and liver cell line (LO2)

[0121] Mix pX458-sgCPS1 (backbone carrier of CPS1 gene) plasmid and pET32-CPSLR-tdTomato (targeting carrier of CPS1 gene) plasmid in a ratio of 1:3 (mass ratio), and mix each 10 6 Human liver cell line cells (HepG2 or LO2) were mixed with 2 μg of mixed plasmids, 1050V 30pulse electric shock twice, and the cells were resuspended in 2mL high-glucose DMEM medium containing 10% (V / V) fetal bovine serum for 24 hours Then add 200 μg / mL G418 (Geneticin, Geneticin) to screen, after 15 days, obtain G418 resistant clone, extract its genomic DNA, use the oligonucleotide (sequence: 5 '-GAAGATCTTTGTGTGAATCTTCAGGAATA-3' and 5'-CCATGTTGTTGTCCTCGGAGGA-3') were amplified by PCR and the PCR amplification products were sequenced to obtain reporter cells of CPS1-tdtomato human liver cell line. CPS1-tdtomato reported HepG2, LO2 cells were labeled as HepG2-CPS-tdTomato (HCT) an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CPS1 reporter gene human liver cell line and its construction method and application. Aminoacylphosphate synthase 1 (CPS1) and a reporter gene are used to construct a human liver cell line. The obtained CPS1 reporter gene human liver cell has the characteristics of human primary adult The functions of liver parenchymal cells, including albumin secretion, cytochrome P450 enzyme metabolism and ammonia metabolism, can be used in artificial livers, drug metabolism research, drug toxicity evaluation or drug screening, and have broad application prospects.

Description

technical field [0001] The invention belongs to the recombinant cell line in the field of bioengineering, in particular to a carbamoyl phosphate synthetase 1 (CPS1)-reporter gene human liver cell line and its construction method and application. Background technique [0002] Of all the organs involved in drug biotransformation, the liver is the most important site. Drug metabolism in the liver is a major way of drug elimination. The metabolism of drugs in the liver is directly related to their pharmacological activity and toxicity characteristics, which in turn affects the clinical safety and effectiveness of drugs. Therefore, the metabolism of drugs in the liver is a very important link in the process of preclinical new drug development. The use of reasonable and effective models to predict drug effects and potential toxicity is crucial to the evaluation of drug metabolism. Compared with the overall model, the in vitro research model is widely used by scientists in drug ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/85C12Q1/02C12R1/91
CPCC12N5/067C12N5/0693C12N9/93C12Y603/04016G01N33/5011G01N33/5014G01N33/5067
Inventor 王韫芳王怡常乐
Owner FIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY