MLD (metachromatic leukodystrophy) lentiviral vector, lentivirus and preparation method and application thereof

A lentiviral vector and lentiviral technology, applied in the field of genetic engineering, can solve the problems of low efficiency and the clinical effect of disease treatment cannot meet expectations, and achieve the effect of improving safety performance, strong stability and high transfection efficiency.

Inactive Publication Date: 2018-10-26
SHENZHEN GENO IMMUNE MEDICAL INST
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, most of the methods of applying cell therapy to treat genetic diseases are too inefficient and only modify blood stem cells, so that the clinical effect of disease treatment has always failed to meet expectations. Therefore, there is an urgent need for methods that can maximize the efficiency of viral gene delivery To improve the treatment of genetic diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MLD (metachromatic leukodystrophy) lentiviral vector, lentivirus and preparation method and application thereof
  • MLD (metachromatic leukodystrophy) lentiviral vector, lentivirus and preparation method and application thereof
  • MLD (metachromatic leukodystrophy) lentiviral vector, lentivirus and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] The construction of embodiment 1 lentiviral vector

[0067] This embodiment provides a method for constructing a lentiviral vector, which specifically includes the following steps:

[0068] (1) Schematic diagram of the transformation of the lentiviral vector pTYF as shown in figure 1 As shown, the specific mutation is to mutate the wild-type 5' splice donor site GT to CA, and delete the enhancer in U3. The specific transformation method can be found in "Contributions of Viral Splice Sites and cis-Regulatory Elements to Lentivirus Vector Function, YAN CUI, JOURNAL OF VIROLOGY, July 1999, p.6171–6176”, as follows:

[0069] Modification of the 5' splice donor site:

[0070] Wild type (SEQ ID NO.4): GGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0071] Mutant type (SEQ ID NO.5): GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0072] (2) Insertion of promoter and ARSA gene:

[0073] Synthesize the normal ARSA gene sequence (as shown in S...

Embodiment 2

[0080] Preparation and identification of embodiment 2 lentivirus

[0081] 1) Preparation of lentivirus

[0082] The lentiviral vector prepared in Example 1 was further packaged, purified and concentrated to obtain the lentivirus. The specific process is as follows: image 3 As shown, the specific steps are as follows:

[0083] (1) Co-transfect the constructed lentiviral vector with the packaging helper plasmids pNHP and pHEF-VSV-G into mammalian cells HEK293T and culture for 24-72h;

[0084] (2) Purifying and concentrating the cultured lentivirus to obtain the lentivirus.

[0085] 2) Identification of lentivirus

[0086] The collected neuron cells and glial cells after transfection with normal ARSA gene lentivirus were identified for protein expression, so as to clarify the expression of ARSA gene in neuron cells.

[0087] From the results, there is no expression of ARSA protein in the negative control cells of neuron cells without lentivirus transfection, but a large amou...

Embodiment 3

[0089] The therapeutic effect of embodiment 3 lentivirus

[0090] The lentivirus carrying normal ARSA prepared in Example 2 is directly injected into the brain to treat MLD disease. The schematic diagram of the treatment process is as follows: Figure 4 As shown, the site of injection of the lentiviral vector and the specific coordinates of the brain are determined by MRI or CT of the brain, and the lentiviral vector carrying the normal ARSA gene is directly injected into the brain of the patient for disease treatment. .

[0091] It can be seen from the results that direct injection of lentivirus can effectively improve the transfer efficiency and expression of ARSA gene in the brain.

[0092] In summary, the lentiviral vector of this application can directly repair the damaged ARSA gene in cells, and can effectively improve the transfer efficiency and expression level of ARSA gene in the brain, which is of great significance to ensure the effectiveness of gene therapy , lay...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an MLD (metachromatic leukodystrophy) lentiviral vector, a lentivirus and a preparation method and application thereof. The lentivirus vector is modified for splicing donor sites at the 5' end of pTYF lentiviral vector, wherein the lentiviral vector further comprises ARSA (arylsulfatase A )genes. The ASRS genes are specifically linked on the basis of the modified lentivirusvector, efficient gene transmission can be achieved while security is ensured, expression of the ARSA genes in transgenic brain cells is significantly increased, and normal gene transmission in the process of MLD gene therapy can be efficiently completed.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to an MLD lentiviral vector, a lentivirus and a preparation method and application thereof, in particular to an optimized expression of the ARSA gene using an improved lentiviral vector for preparing and treating metachromatic leukoencephalopathy Adverse drugs. Background technique [0002] Metachromatic Leukodystrophy (MLD), also known as ARSA deficiency (arylsulfatase A deficiency), is a genetic disease of chromosomal mutation. The cause of the disease is that due to the lack of enzyme arylsulfatase A (ARSA) in the brain nerve cells, the sulfatase cannot be decomposed, so that the sulfatide accumulates in the brain nervous system and damages the nerve cells, especially the oligodendrocytes and neurons, and the CNS and Progressive demyelination occurs in the PNS, most notably progressive neurological dysfunction, with early weakness, hypotonia, and slurred speech, and la...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N7/01C12N5/10A61K48/00A61K38/17A61P3/00A61P25/28
CPCA61K38/1709A61K48/0025A61K48/005A61P3/00A61P25/28C12N5/0634C12N5/0662C12N7/00C12N15/86C12N2510/00C12N2740/15021C12N2740/15043A61K38/465A61K48/0075C12N2740/16043C12N2740/16062C12Y301/06001
Inventor朱章英
OwnerSHENZHEN GENO IMMUNE MEDICAL INST