MLD (metachromatic leukodystrophy) lentiviral vector, lentivirus and preparation method and application thereof
A lentiviral vector and lentiviral technology, applied in the field of genetic engineering, can solve the problems of low efficiency and the clinical effect of disease treatment cannot meet expectations, and achieve the effect of improving safety performance, strong stability and high transfection efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] The construction of embodiment 1 lentiviral vector
[0067] This embodiment provides a method for constructing a lentiviral vector, which specifically includes the following steps:
[0068] (1) Schematic diagram of the transformation of the lentiviral vector pTYF as shown in figure 1 As shown, the specific mutation is to mutate the wild-type 5' splice donor site GT to CA, and delete the enhancer in U3. The specific transformation method can be found in "Contributions of Viral Splice Sites and cis-Regulatory Elements to Lentivirus Vector Function, YAN CUI, JOURNAL OF VIROLOGY, July 1999, p.6171–6176”, as follows:
[0069] Modification of the 5' splice donor site:
[0070] Wild type (SEQ ID NO.4): GGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;
[0071] Mutant type (SEQ ID NO.5): GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;
[0072] (2) Insertion of promoter and ARSA gene:
[0073] Synthesize the normal ARSA gene sequence (as shown in S...
Embodiment 2
[0080] Preparation and identification of embodiment 2 lentivirus
[0081] 1) Preparation of lentivirus
[0082] The lentiviral vector prepared in Example 1 was further packaged, purified and concentrated to obtain the lentivirus. The specific process is as follows: image 3 As shown, the specific steps are as follows:
[0083] (1) Co-transfect the constructed lentiviral vector with the packaging helper plasmids pNHP and pHEF-VSV-G into mammalian cells HEK293T and culture for 24-72h;
[0084] (2) Purifying and concentrating the cultured lentivirus to obtain the lentivirus.
[0085] 2) Identification of lentivirus
[0086] The collected neuron cells and glial cells after transfection with normal ARSA gene lentivirus were identified for protein expression, so as to clarify the expression of ARSA gene in neuron cells.
[0087] From the results, there is no expression of ARSA protein in the negative control cells of neuron cells without lentivirus transfection, but a large amou...
Embodiment 3
[0089] The therapeutic effect of embodiment 3 lentivirus
[0090] The lentivirus carrying normal ARSA prepared in Example 2 is directly injected into the brain to treat MLD disease. The schematic diagram of the treatment process is as follows: Figure 4 As shown, the site of injection of the lentiviral vector and the specific coordinates of the brain are determined by MRI or CT of the brain, and the lentiviral vector carrying the normal ARSA gene is directly injected into the brain of the patient for disease treatment. .
[0091] It can be seen from the results that direct injection of lentivirus can effectively improve the transfer efficiency and expression of ARSA gene in the brain.
[0092] In summary, the lentiviral vector of this application can directly repair the damaged ARSA gene in cells, and can effectively improve the transfer efficiency and expression level of ARSA gene in the brain, which is of great significance to ensure the effectiveness of gene therapy , lay...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


