Dual fluorescence quantitation method for MO (mycoplasma ovipneumonia) and Mmc (Mycoplasma mycoides subsp.capri)
A Mycoplasma pneumoniae, dual fluorescence technology, applied in biochemical equipment and methods, microorganism-based methods, recombinant DNA technology, etc., to achieve the effects of cost saving, strong specificity, and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] A dual fluorescence quantitative PCR method for Mycoplasma ovipneumoniae and Mycoplasma mycoplasma goat subspecies, including:
[0059] (1) Design and synthesis of primers and probes:
[0060] According to the Mo p113 gene and Mmc MLC_1770 gene sequence published on GenBank, using Beacon Designer7.9 software, combined with NCBI Blast online analysis, two pairs of specific primers and probes for Mo and Mmc were designed to detect Mycoplasma ovis pneumoniae. The sequences of specific primers and probes are:
[0061] Upstream primer Mo-F: 5’-CTTCGGGACTTATTGGAG-3’;
[0062] Downstream primer Mo-R: 5’-GATGCAAACTGATTTACTTG-3’;
[0063] Fluorescent probe Mo-P: 5’-FAM- AAGACCGATTGTCAGGCCGA -Eclipse-3’;
[0064] The sequences of specific primers and probes designed to detect Mycoplasma mycoplasma goat subspecies are:
[0065] Upstream primer Mmc-F: 5’-CTAGCTAGCATAGTTGTTG-3’;
[0066] Downstream primer Mmc-R: 5’- GCTTGAACAACTATATTGTA -3’;
[0067] Fluorescent probe Mmc-P: 5’-TET-TAACACAGTTAAA...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com