Tobacco chloride ion channel protein NtCLC2 and application thereof
A chloride ion channel and chloride ion technology, applied in the field of tobacco genetic engineering, can solve the problems of poor industrial practicability of tobacco leaf quality, lack of good practicability and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] This example mainly focuses on tobacco chloride channel protein NtCLC2 The process of obtaining genes is briefly introduced as follows.
[0049] Take cultivated tobacco leaves as samples, use RNA extraction kit to extract total RNA from tobacco leaves, and reverse transcription into cDNA for use;
[0050] By homology comparison method, refer to Arabidopsis thaliana AtCLC2 The sequence of the gene and the known partial gene sequence of tobacco, the sequence of the designed amplification primer is as follows:
[0051] F: 5’- CGCGAGCTCGGTACCATGGAAGATCAAGGTGAT -3’,
[0052] R: 5’- GCTCACCATGGATCCCTTGTGATGGACCAAAT -3’;
[0053] Using the cDNA prepared above as a template, PCR amplification was performed using the above primers.
[0054] The PCR reaction system is:
[0055] 1μL of upstream primer,
[0056] 1μL of downstream primer,
[0057] cDNA 1μL,
[0058] 10×buffer 5μL,
[0059] dNTP 6μL,
[0060] EazyTaq enzyme 1μL,
[0061] Add ddH 2 O to 50μL.
[0062] PCR reaction program: 94°C pre-den...
Embodiment 2
[0071] For sure NtCLC2 The function of genes in tobacco, selection NtCLC2 The specific nucleic acid fragment in the gene (the 1426th-1738th nucleotide sequence of SEQ IDNO.1 in the sequence table) was used as the guide sequence to construct the silence NtCLC2 Transgenic plants were constructed by using VIGS vector for transient silencing of genes and further transformed tobacco plants. The relevant experimental procedures are briefly introduced as follows.
[0072] (1) Construction of VIGS vector for transient silence
[0073] First, design the primer sequences for PCR amplification as follows:
[0074] NtCLC2 -F: 5’- CGACGACAAGACCCTCTTGGCGTCGTTACTTAT-3’,
[0075] NtCLC2 -R: 5’- GAGGAGAAGAGCCCTTTCACAATCTGGTCATAG-3’;
[0076] Carry out PCR amplification (amplification length: 312bp) with the above primer sequence to obtain VIGS guide sequence;
[0077] Secondly, use the In-Fusion method to connect the amplified guide sequence to the TRV vector (connected at 50°C for 15 minutes), screen an...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



