Multi-component group B meningococcus vaccine and preparation method thereof

A meningococcal and multi-component technology is applied in the field of multi-component B meningococcal vaccine and its preparation, and can solve the problems of lack of bactericidal power and the like

Pending Publication Date: 2018-12-07
BEIJING ZHIFEI LVZHU BIOPHARM +2
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Antibodies generated by immunization with recombinant fHbp elicited complement-mediated bactericidal action against the same subfamily and induced passive protection in a suckling mouse model of infection, but were not bactericidal against strains of different subfamily

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multi-component group B meningococcus vaccine and preparation method thereof
  • Multi-component group B meningococcus vaccine and preparation method thereof
  • Multi-component group B meningococcus vaccine and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Embodiment 1: Construction of group B meningococcal low endotoxin mutant strain:

[0082] In this embodiment, the ST4821 clone group 341215 strain of meningococcus B epidemic strain is taken as an example.

[0083] 1.1 According to the lpxA gene sequence of group B meningococcus, design and synthesize primers as follows:

[0084] 5' TGATTACGCCAAGCTTCAAAAACTCATCCCCCCA 3'

[0085] 5'TATCAATCACGTTTTTCCTTTTCCTGTCG 3'

[0086] Use the primers to PCR amplify the upstream 500bp sequence of the lpxA gene of group B meningococcal strain 341215;

[0087] 1.2 According to the lpxA gene sequence of Escherichia coli DH5α strain, design synthetic primers as follows:

[0088] 5'AAGGAAAAACGTGATTGATAAATCCGCC 3'

[0089] 5'TATGGCTCATTTAACGAATCAGACCGCG 3'

[0090] Using the primers to PCR amplify the lpxA gene of Escherichia coli DH5α strain;

[0091] 1.3 According to the kanamycin resistance gene sequence on the pET28a plasmid, design synthetic primers as follows:

[0092] 5'GATTC...

Embodiment 2

[0107] Example 2: Extraction of group B meningococcal low endotoxin mutant strain OMV

[0108] 2.1 Cultivation of group B meningococcal low endotoxin mutant strains

[0109] Spread and inoculate the low-endotoxin mutant strain of group B meningococcus frozen at -70°C on 10% sheep blood ordinary agar medium, at 37°C, 5% CO 2 Incubate overnight. Scrape the bacterial lawn and inoculate it into the nutrient broth medium, cultivate it at 37°C and 180rpm for 4-6 hours, and gradually expand the culture in 30L, 100L, and 500L fermenters until the OD value is about 6-12, and add a final concentration of 0.01-0.1ug / ml of sodium deoxycholate solution sterilized for 5-20 minutes.

[0110] 2.2 Extraction of group B meningococcal low endotoxin mutant strain OMV

[0111] Take the fermented bacteria liquid and collect the bacteria by centrifugation in a disc centrifuge, suspend the bacteria in 50mM PB, 1mM Na2·EDTApH7.2 solution 5-10 times, and then homogeneously crush 2-3 times at 1000-1...

Embodiment 3

[0112] Embodiment 3: Preparation of fHbp-A recombinant lipoprotein

[0113] 3.1 Construction of fHbp-A / BL21(DE3) engineering bacteria

[0114] According to the amino acid sequence of fHbp-A, Haemophilus influenzae P4 outer membrane protein signal peptide and the codon preference of Escherichia coli, the P4 signal peptide was directly located at the N-terminus of fHbp-A, and the full-length DNA sequence was designed and synthesized on plasmid pUC57;

[0115] The pUC57 synthetic plasmid was treated with restriction endonucleases NdeI and XhoI to obtain a large fragment of (p4)fhbp-A gene.

[0116] Treat the pET43.1a plasmid with restriction endonucleases NdeI and XhoI to obtain the digested plasmid pET43.1a, such as figure 2 .

[0117] The treated target gene fragment (P4) fHbp-A and plasmid pET43.1a were ligated with a recombinase, and the ligated product was transformed into E.coli DH5α, and cultured overnight at 37°C. Positive clones were picked and inoculated in LB (Amp) l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a multi-component group B meningococcus vaccine and a preparation method thereof. The multi-component group B meningococcus vaccine disclosed by the invention comprises a groupB meningococcus low-endotoxin mutant outer membrane vesicle (OMV), recombinant lipoproteins (fHbp-A, fHbp-B) of group B meningococcus subfamily A and subfamily B human factor H binding proteins (fHbp), a group B meningococcus neisserial adhesion A (NadA) recombinant protein, and a group B meningococcus neisseria heparin binding antigen (NHBA) recombinant protein. The vaccine disclosed by the invention is used for preventing cerebrospinal meningitis, bacteremia, pneumonia, pericarditis and other invasive diseases caused by the group B meningococcus, and provides wide effective protection effects to the group B meningococcus.

Description

technical field [0001] The invention relates to a multi-component group B meningococcal vaccine and a preparation method thereof, belonging to the field of biological products. The multi-component group B meningococcal vaccine is composed of group B meningococcal low endotoxin mutant strain OMV, group B meningococcal recombinant fHbp-A lipoprotein and recombinant fHbp-B lipoprotein, and recombinant NadA protein and recombinant A vaccine preparation prepared by mixing NHBA proteins in proportion. Background technique [0002] Epidemic meningitis (referred to as meningitis) is a respiratory infection mainly caused by meningitis and bacteremia caused by Neisseria Meningitides (NM, NM, commonly referred to as meningococcus) infection sick. At present, infants and young children are the main cases, showing endemic, outbreak, and sporadic forms. The invasive diseases caused by NM include meningitis, bacteremia, and pneumonia, etc., and the case fatality rate is about 12% to 20%....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/095A61P31/04C12N15/70C12N1/21C07K14/775
CPCA61K39/095A61K2039/70A61P31/04C07K14/775C12N15/70
Inventor苏桂民郭通纪国存冀颖杜琳
OwnerBEIJING ZHIFEI LVZHU BIOPHARM