Primer probe group and kit for combined detection of Sindbis virus and Getah virus based on dual fluorescence PCR method
A technology of getta virus, primer probe, applied in the direction of microorganism-based methods, microorganisms, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Design and synthesis of detection primer probes for Sindbis virus and Geta virus double detection kit (fluorescent PCR method):
[0033] Synthesize Sindbis virus-specific primers, Sindbis virus probes, specific primers for Geta virus and Geta virus probes according to SEQ ID No.1-6, and label FAM at the 5' of Sindbis virus probes The fluorescent group, the 5'-labeled HEX fluorescent group of the Geta virus probe, and the 3' end of both are labeled with BHQ1, and the primer probes for Sindbis virus and Geta virus are synthesized. The primers and probe sequences are as follows:
[0034] Sindbis virus:
[0035]Upstream primer: CTAAAGGTACATTTCAATCA (SEQ ID No.1)
[0036] Downstream primer: ATATCGATTTCAATGTTCTT (SEQ ID No.2)
[0037] Probe: 5' fluorescent reporter group-CCAAGACATTCTACAAGTATATCTC-BHQ13' (SEQ ID No.5)
[0038] Geta virus:
[0039] Upstream primer: GTAAAGAAGATCACCATAAG (SEQ ID No.3)
[0040] Downstream primer: TATCAGTGATCTTTACACATC (SEQ ID No.4)
[0041] ...
Embodiment 2
[0043] Sindbis virus and Geta virus double nucleic acid detection kit (fluorescent PCR method) detection mixture preparation:
[0044] According to Sindbis virus upstream primer 0.5μl / test; downstream primer 0.5μl / test; probe 0.25μl / test; Geita virus upstream primer 0.5μl / test; downstream primer 0.5μl / test; probe 0.25μl / test; The concentration is 10μM, the probe concentration is 10μM; PCR MIX 12.5μl / test; process water (ddH 2 O) Mix at 5 μl / test to obtain the nucleic acid fluorescent PCR detection mixture.
Embodiment 3
[0046] Sensitivity Analysis of Sindbis Virus and Geta Virus Dual Nucleic Acid Detection Kit (Fluorescent PCR Method):
[0047] 3.1 Sample preparation:
[0048] Take 1×10 9 Copies / ml Sindbis virus plasmid (SINV-S1) (cloning the target amplification sequence to the PEGM-T vector by TA to obtain the SINV-S1 plasmid. The target amplification sequence is:
[0049] CTAAAGGTACATTTCAAATCACCCTGAAAAAGACATATGCACCAAGACATTCTACAAGTATATCTCCCGGCGTTGCACACAGCCAGTTACAGCTATTGTATCGACACTGCATTACGATGGAAAGATGAAAACCACGAACCCGTGCAAGAAGAACATTGAAATCGATAT (SEQ ID No. 7)) was divided into 5 parts, and 4 parts were obtained by 10 times, 100 times, 1000 times, 1000 times, 100, 8 copies / ml), SINV-S3 (1×10 7 copies / ml), SINV-S4 (1×10 6 copies / ml), SINV-S5 (1×10 5 copies / ml), a total of 5 copies were obtained as test samples.
[0050] Take 1×10 9 Geta virus plasmid (GETA-S1) of copies / ml (the GETA-S1 plasmid obtained by cloning the target amplified sequence into the PEGM-T vector by TA. The target amplified...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com