An SNP marker for identifying Corydalis turtschaninovii Bess., an allele-specific PCR process and application
An allele-specific, Corydalis technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial determination/inspection, etc., can solve problems such as the specific identification of dental flap Corydalis, and achieve stable specificity and sensitivity. , good stability and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] See Table 1 for the Corydalis plant material and its sources in Example 1. The plant names in Table 1 are recorded in literature (Zhang Mingli, Su Zhiyun, Magnus Lidén.Corydalis DC.[M] / / Wu Z Y, Raven P H, HongD Y.Flora of China.Vol.7.Beijing:Sciences Press , St. Louis: Missouri Botanical Garden Press, 2008:295-428.) and (Ki keman Zoku. Corydalis DC. In: Flora of Japan [M]. Washington: Smithsonian Institution. 1965:476.). A total of 72 samples of 14 kinds of plants were collected from plants of different populations in natural distribution areas such as Anhui, Jiangsu, Zhejiang, Henan, Shandong, Heilongjiang, Jilin, Liaoning and Xinjiang. The others are wild. All samples were identified by Professor Peng Huasheng of Anhui University of Traditional Chinese Medicine, and the plant certificate specimens were deposited in the School of Pharmacy of Anhui University of Traditional Chinese Medicine.
[0037] Table 1 is wild plant materials and sources
[0038]
[0039] ...
Embodiment 2
[0041] See Table 2 for the medicinal materials and sources thereof in Example 2. The plant names of the medicinal materials in Table 2 are recorded in the literature (Zhang Mingli, Su Zhiyun, Magnus Lidén.Corydalis DC.[M] / / Wu Z Y, Raven P H, HongD Y.Flora of China.Vol.7.Beijing : Sciences Press, St. Louis: Missouri Botanical Garden Press, 2008: 295-428.). A total of 14 medicinal material samples were purchased from medicinal material markets and pharmacies in Bozhou, Anhui (Table 2).
[0042] Table 2 medicinal materials
[0043]
[0044] 10×PCR Buffer, dNTP and Ex Taq enzyme: purchased from Takara;
[0045] Example 1
[0046] Acquisition of SNP Molecular Markers in Corydalis dentata
[0047]For the sequenced trnG sequences of 56 samples from 14 species of Corydalis genus Corydalis and Corydalis group, homologous alignment was performed using BioEdit 7.2.2 software, and the unique SNP sites of Corydalis were observed after manual correction. We found that the 229th G co...
Embodiment 3
[0057] Template acquisition and quality inspection
[0058] DNA extraction: take 20 mg of silica gel-dried leaves for plant materials, and take 100 mg of medicinal material powder after passing through a No. 5 sieve, and extract total DNA according to the improved CTAB method;
[0059] Quality inspection: Utilize the ultraviolet absorption method of the nucleic acid protein analyzer to measure the concentration and purity of the double-stranded DNA template, and use the universal primers trnH (sequence is CGCGCATGGTGGATTCACAATCC) and psbA (sequence is GTTATGCATGAACGTAATGCTC) to amplify the sample to check the quality of the template DNA. The PCR reaction system is 25 μL, including 60ng DNA template, 0.5 μL each of upstream primer and downstream primer (10pmoL / μL), 0.125 μL Ex Taq DNA polymerase (5U / μL), 2.5 μL 10×PCR Buffer, 2 μL dNTP, 20 μL H 2 O. react in carried out on a 96-well gradient PCR machine. The reaction program is 94°C for 4min; 30 cycles: 94°C for 30s, 53°C f...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap