Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

An SNP marker for identifying Corydalis turtschaninovii Bess., an allele-specific PCR process and application

An allele-specific, Corydalis technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial determination/inspection, etc., can solve problems such as the specific identification of dental flap Corydalis, and achieve stable specificity and sensitivity. , good stability and high accuracy

Inactive Publication Date: 2018-12-14
ANHUI UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although there are DNA barcoding studies on Corydalis genus, no specific identification of Corydalis corydalis has been found yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An SNP marker for identifying Corydalis turtschaninovii Bess., an allele-specific PCR process and application
  • An SNP marker for identifying Corydalis turtschaninovii Bess., an allele-specific PCR process and application
  • An SNP marker for identifying Corydalis turtschaninovii Bess., an allele-specific PCR process and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] See Table 1 for the Corydalis plant material and its sources in Example 1. The plant names in Table 1 are recorded in literature (Zhang Mingli, Su Zhiyun, Magnus Lidén.Corydalis DC.[M] / / Wu Z Y, Raven P H, HongD Y.Flora of China.Vol.7.Beijing:Sciences Press , St. Louis: Missouri Botanical Garden Press, 2008:295-428.) and (Ki keman Zoku. Corydalis DC. In: Flora of Japan [M]. Washington: Smithsonian Institution. 1965:476.). A total of 72 samples of 14 kinds of plants were collected from plants of different populations in natural distribution areas such as Anhui, Jiangsu, Zhejiang, Henan, Shandong, Heilongjiang, Jilin, Liaoning and Xinjiang. The others are wild. All samples were identified by Professor Peng Huasheng of Anhui University of Traditional Chinese Medicine, and the plant certificate specimens were deposited in the School of Pharmacy of Anhui University of Traditional Chinese Medicine.

[0037] Table 1 is wild plant materials and sources

[0038]

[0039] ...

Embodiment 2

[0041] See Table 2 for the medicinal materials and sources thereof in Example 2. The plant names of the medicinal materials in Table 2 are recorded in the literature (Zhang Mingli, Su Zhiyun, Magnus Lidén.Corydalis DC.[M] / / Wu Z Y, Raven P H, HongD Y.Flora of China.Vol.7.Beijing : Sciences Press, St. Louis: Missouri Botanical Garden Press, 2008: 295-428.). A total of 14 medicinal material samples were purchased from medicinal material markets and pharmacies in Bozhou, Anhui (Table 2).

[0042] Table 2 medicinal materials

[0043]

[0044] 10×PCR Buffer, dNTP and Ex Taq enzyme: purchased from Takara;

[0045] Example 1

[0046] Acquisition of SNP Molecular Markers in Corydalis dentata

[0047]For the sequenced trnG sequences of 56 samples from 14 species of Corydalis genus Corydalis and Corydalis group, homologous alignment was performed using BioEdit 7.2.2 software, and the unique SNP sites of Corydalis were observed after manual correction. We found that the 229th G co...

Embodiment 3

[0057] Template acquisition and quality inspection

[0058] DNA extraction: take 20 mg of silica gel-dried leaves for plant materials, and take 100 mg of medicinal material powder after passing through a No. 5 sieve, and extract total DNA according to the improved CTAB method;

[0059] Quality inspection: Utilize the ultraviolet absorption method of the nucleic acid protein analyzer to measure the concentration and purity of the double-stranded DNA template, and use the universal primers trnH (sequence is CGCGCATGGTGGATTCACAATCC) and psbA (sequence is GTTATGCATGAACGTAATGCTC) to amplify the sample to check the quality of the template DNA. The PCR reaction system is 25 μL, including 60ng DNA template, 0.5 μL each of upstream primer and downstream primer (10pmoL / μL), 0.125 μL Ex Taq DNA polymerase (5U / μL), 2.5 μL 10×PCR Buffer, 2 μL dNTP, 20 μL H 2 O. react in carried out on a 96-well gradient PCR machine. The reaction program is 94°C for 4min; 30 cycles: 94°C for 30s, 53°C f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP marker for identifying Corydalis turtschaninovii Bess., an allele-specific PCR process and application, and relates to the technical field of biology. The SNP marker andthe process are provided based on a problem that there is no specific identification method for Corydalis turtschaninovii Bess.. The invention discloses the SNP marker for identifying Corydalis turtschaninovii Bess., the application of the SNP marker, a specific primer pair T1 for detecting Corydalis turtschaninovii Bess. based on allele PCR detection, and the allele-specific PCR process for Corydalis turtschaninovii Bess. detection. Beneficial effects of the SNP marker, the application, the process, and the specific primer pair are that accurate identification of the Corydalis turtschaninovii Bess. and processing products thereof are achieved, and advantages including high accuracy, high stability, high specificity, no need of sequencing, and no influence caused by medicinal parts are achieved.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a SNP marker for identifying Corydalis corydalis, an allele-specific PCR method and its application. Background technique [0002] Corydalis corydalis is the oldest Corydalis herbal medicine recorded in Materia Medica, which can be traced back to "Supplements to Materia Medica" written by Chen Zangqi in the Tang Dynasty. Corydalis turtschaninovii Bess. is a traditional medicinal material in Northeast my country, mainly distributed in Jilin, Liaoning, Heilongjiang, northeast Inner Mongolia and northeast Hebei. The medicinal material Rhizoma Corydalis recorded in "Drug Standards of Jilin Province" is derived from the dry tuber of Corydalis remota Fisch.ex Maxim. According to the latest revision of the Corydalis classification system by Zhang Mingli et al., C.remota is a synonym of Corydalis dentata . In addition, the 2016 edition of "Japanese Pharmacopoeia Prescription" recorded that...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156C12Q2600/13
Inventor 程铭恩蒋露彭华胜查良平产清云于大庆
Owner ANHUI UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com