Nucleic acid aptamer and its application in the detection of neuronecrosis virus derived from pompano ovata

A nucleic acid aptamer and nucleotide sequence technology, which can be applied to measurement devices, instruments, biochemical equipment and methods, etc., can solve the problems of inability to detect and diagnose the oval pomfret-derived nerve necrosis virus, and achieve convenient in vitro chemical Synthetic, easy to label, small molecular weight effect

Active Publication Date: 2021-11-30
GUANGXI ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention aims to provide a highly specific, highly sensitive, non-immunogenic, stable, easy-to-modify, easy-to-synthesize and preserve ssDNA nucleic acid aptamer for detecting neuronecrosis virus derived from pompano pomfret, to at least solve the current problem The problem that some biological detection techniques cannot quickly and accurately detect and diagnose the neuronecrosis virus of pomfret ovata on the spot

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer and its application in the detection of neuronecrosis virus derived from pompano ovata
  • Nucleic acid aptamer and its application in the detection of neuronecrosis virus derived from pompano ovata
  • Nucleic acid aptamer and its application in the detection of neuronecrosis virus derived from pompano ovata

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 The preparation method of SSDNA nucleic acid adapter is as follows:

[0038] Step 1: Single-stranded DNA libraries and primers shown in the following sequences:

[0039] Random library library50:

[0040] 5'-gtctgaagtagacgcaggag (50n) agtcacctgagtaagcgt

[0041] 5 'primers: 5'-fam-gtctgaagtagacgcaggag-3';

[0042] 3 'primers: 5'-biotin-acgcttactcaggtgtgact-3';

[0043] Step 2: Take 10 nmol The random library is dissolved in 500 μl of PBS, 5 min at 92 ° C, then quickly ice bath, ice bath 10min, and take the treated random library and GTONNV infected cells to incubate on ice 1h; After the completion of the combination, the supernatant was centrifuged, and 10 ml of PBS was washed with GTONNV infected cells, and 10 min at a constant temperature water bath at 92 ° C and centrifuged at 12000 g of 1-20 min, and the supernatant was collected, the supernatant SSDNA nucleic acid adapter library for specific recognition of GTONNV infected cells;

[0044] Step 3: Take 100 ul ...

Embodiment 2

[0055] Example 2 The preparation method of SSDNA nucleic acid adapter is as follows:

[0056] Step 1: Single-stranded DNA libraries and primers shown in the following sequences:

[0057] Random library library50:

[0058] 5'-gtctgaagtagacgcaggag (50n) agtcacctgagtaagcgt

[0059] 5 'primers: 5'-fam-gtctgaagtagacgcaggag-3';

[0060] 3 'primers: 5'-biotin-acgcttactcaggtgtgact-3';

[0061] Step 2: Take 10 nmol The random library is dissolved in 500 μl of PBS, 5 min at 92 ° C, then quickly ice bath, ice bath 10min, and take the treated random library and GTONNV infected cells to incubate on ice 1h; After the completion of the combination, the supernatant was centrifuged, and 10 ml of PBS was washed with GTONNV infected cells, and 10 min at a constant temperature water bath at 92 ° C and centrifuged at 12000 g of 1-20 min, and the supernatant was collected, the supernatant SSDNA nucleic acid adapter library for specific recognition of GTONNV infected cells;

[0062] Step 3: Take 100 ul ...

Embodiment 3

[0085] The secondary structure of the nucleic acid fitting is predicted online with Mfold software online.

[0086] SEQ ID NO: 1 secondary structural prediction result of nucleic acid body fit image 3 As shown, the nucleic acid adapter forms a special stem ring structure and a cardboard structure.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a ssDNA nucleic acid aptamer and its application in detecting cells infected with neuronecrosis virus derived from pompano pomfret. The nucleotide sequence of the ssDNA nucleic acid aptamer is 5'-GTCTGAAGTAGACGCAGGAGGCTCGGGGCTCGATATTGTAAAGGGAGTGTGTTTAGGAGGACGTGGTTGGAGTCACACCTGAGTAAGCGT‑3'( SEQ ID NO: 1) or 5'-GCTCGGGGCTCGATATTGTAAAGGGAGTGTGTTTAGGAGGACGTGGTTGG-3' (SEQ ID NO: 2). The ssDNA nucleic acid aptamer of the present invention has specificity and high sensitivity to cells infected with neuronecrosis virus derived from pompano pomfret and has no immunogenicity. The ssDNA nucleic acid aptamer has high specificity, high affinity, no cytotoxicity, is stable and easy to modify, and is convenient for synthesis and storage, and can quickly and accurately detect and diagnose cells infected with neuronecrosis virus from pomfret ovata.

Description

Technical field [0001] The present invention relates to an SSDNA nucleic acid suitable ligand and a screening method, a detection method, and a method, particularly to an SSDNA nucleic acid fitting and its application in detecting oval-derived neural necrosis viruses. Background technique [0002] As a aquaculture big country, my country is 70% of the total aquaculture of the world aquaculture. Guangxi is the large province of the aquaculture in my country. The main breeding varieties include ovate, grassfish, spotted fork, grouper, shrimp, oysters, mache beads and various edible plants. However, with the acceleration of urbanization, industrialization, and cultivation, the Guangxi aquaculture environment has deteriorated, and various diseases have expired, resulting in huge economic losses. In 2017, the ovitation of the oviva necrosis of the North Sea Nettle Bank in Guangxi, and the diseased ovariosis was identified by the diseased oval-like disease, and the ovitation of the ova...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/115C12N15/10G01N33/569
CPCC12N15/1048C12N15/115C12N2310/16G01N33/56983
Inventor李鹏飞余庆刘明珠李菲吴思婷肖贺贺
OwnerGUANGXI ACAD OF SCI