Primer, probe, kit and method for detecting transgenic maize TC1507

A technology of transgenic corn and a detection kit, which is applied in the field of molecular biology, can solve the problems that there are no detection methods and kits for detecting transgenic corn TC1507, and achieve the effect of simple operation and strong specificity

Inactive Publication Date: 2019-01-11
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no detection method and kit for detection of transgenic corn TC1507 using RPA method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe, kit and method for detecting transgenic maize TC1507

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Design and screening of transgenic maize TC1507 RPA detection primers and probes

[0030] The target region detected by TC1507 RPA in the present invention is the transformant-specific sequence of TC1507, that is, the junction region sequence between the exogenous insert and the maize genome, wherein

[0031] The forward and reverse primers are located on both sides of the junction, and the probe covers the junction region.

[0032] (1) Primer design

[0033] 5 primers were respectively designed on both sides of the connection point, and the length of the primers was 30-32bp. The sequences of the screening primers of the present invention are as follows:

[0034] F1:CTCTCTCTATAATAATGTGTGAGTAGTTCCCA;

[0035] F2: AGGGAATTAGGGTTCTTATAGGGTTTCGCTCA;

[0036] F3: CATGTGTTGAGCATATAAGAAACCCTTAGTAT;

[0037] F4: GTATGTATTTGTATTTGTAAAATACTTCTATC;

[0038] F5: ACCCTTAGTATGTATTTGTATTTGTAAAATAC;

[0039] R1: CTCTAGAGGATCCACCCGGGCTCGAGCTCGA;

[0040] R2:AGAGGCGCGCCG...

Embodiment 2

[0049] The optimization of embodiment 2RPA reaction system

[0050] (1) Determination of amplification temperature

[0051] Under the condition that other amplification conditions of RPA are the same, carry out RPA amplification in the temperature range of 30-45°C, determine the optimal amplification temperature of RPA according to the strength of the fluorescence signal intensity at different temperatures, and finally determine the optimal amplification The temperature was 39°C.

[0052] (2) Determine the concentration of primers and probes

[0053] Primers and probes were prepared at the same concentration, 10 μmol / L, and other amplification conditions of RPA were the same. Amplification was performed at the optimum amplification temperature of 39°C, and primers and probe combinations with different concentrations were amplified. The strength of the fluorescent signal intensity under the combination determines the optimal primer and probe concentration of RPA, and finally ...

Embodiment 3

[0054] The establishment of embodiment 3 kit and detection method thereof

[0055] The RPA detection kit of transgenic corn TC1507 was prepared according to the following formula, and the specification of each kit was 50 reactions:

[0056] (1) Detection primer and probe solution: Synthesize forward primer F, reverse primer R and probe P, and prepare the dry powder of primer and probe with sterilized deionized water or ultrapure water with a concentration of 10 μmol / L respectively. Mother liquor, wherein the primer sequences are:

[0057] Forward primer F: ACCCTTAGTATGTATTTGTATTTGTAAAATAC

[0058] (SEQ ID NO: 1);

[0059] Reverse primer R: CTCTAGAGGATCCACCCGGGCTCGAGCTCGA (SEQ ID NO: 2).

[0060] Probe P: TAAAATTTCTAATTCCTAAAACCAAAA[FAM-dT]cc[THF]g[BHQ1-dT]GGCGAGCTCGAAT-C3Spacer (SEQ ID NO: 3).

[0061] (2) BufferA (1.5mL): containing 50mmol / L Tris-HCl, pH 8.4, 80mmol / L KAc, 2mmol / LDTT, 3mmol / L ATP, 200μmol / L dNTPs, 20mmol / L C 4 h 10 N 3 o 5 P, 100ng / μL creatine kinase,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a combination of a primer and a probe, a kit and method for detecting transgenic maize TC1507. The primer set consists of two specific primers, the nucleotide sequence of whichwas shown in SEQ ID NO: 1-2 and the probe sequence in SEQ ID NO: 3. The kit comprises a testing primer and probe solution, Buffer A, Buffer B and a positive control. The specific primers and probes were used to detect the recombinant enzyme, Single stranded DNA binding protein (SSB), strand substitution DNA polymerase (SSR-DNA polymerase) and exonuclease are used to amplify DNA template at 37-42DEG C. The fluorescence signal of probe was collected to determine whether the sample contained transgenic maize TC1507 or not. The invention does not need special instrument, has the characteristicsof fast and high efficiency, simple and convenient operation, high sensitivity, strong specificity and the like, and is suitable for on-site detection.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection method for transgenic plants and products thereof, in particular to a combination of primers and probes and reagents for rapidly detecting transgenic corn TC1507 using recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA) Boxes and assay methods. Background technique [0002] In 2016, the global planting area of ​​genetically modified crops reached 185.1 million hectares, an increase of more than 100 times compared with the initial commercialization in 1996. Currently commercially grown genetically modified crops mainly include soybeans, corn, cotton, and rapeseed. Transgenic corn TC1507 is an insect-resistant and herbicide-tolerant transgenic corn developed by DuPont, which has been approved by the Chinese government to be imported as a processing raw material. Research on rapid and accurate detection methods for transg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/6895C12Q2521/507C12Q2522/101
Inventor徐俊锋汪小福陈笑芸彭城徐晓丽魏巍
OwnerZHEJIANG ACADEMY OF AGRICULTURE SCIENCES