Primers and probes for detecting porcine infectious gastroenteritis virus, fluorescent quantitative PCR kit, method and application
A fluorescent quantitative and detection reagent technology, applied in the field of virus PCR detection, can solve the problems of cumbersome operation, long detection time, insufficient specificity and sensitivity, etc., and achieve the effect of good repeatability, high sensitivity and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Example 1 Primers and Probes
[0057] The embodiment of the present invention provides a primer and probe for specific detection of TGEV, wherein:
[0058] The primer sequences are as follows:
[0059] Upstream primer: 5'TTGTCTGGGTTGCCAAGGAT 3',
[0060] Downstream primer: 5' TCATTATTAGCACCACGACTACCAA 3';
[0061] The probe sequence is as follows:
[0062] 5' FAM-CCATGAACAAACCAAC-MGB 3'.
Embodiment 2
[0063] Example 2 Fluorescent quantitative PCR detection reagent
[0064] An embodiment of the present invention provides a fluorescent quantitative PCR detection reagent for detecting TGEV, which includes the following components: reaction mixture, water, and primers and probes for detecting TGEV; wherein,
[0065] The primer sequences are as follows:
[0066] Upstream primer: 5'TTGTCTGGGTTGCCAAGGAT 3',
[0067] Downstream primer: 5' TCATTATTAGCACCACGACTACCAA 3';
[0068] The probe sequence is as follows:
[0069] 5' FAM-CCATGAACAAACCAAC-MGB 3'.
[0070] The reaction mixture was Premix Ex Taq (Probe qPCR) produced by TaKaRa Company; the water was RNase-free Water produced by TaKaRa Company.
Embodiment 3
[0071] Example 3 Fluorescent quantitative PCR kit
[0072] The embodiment of the present invention provides a fluorescent quantitative PCR kit for preparing and detecting TGEV, specifically a kit containing the fluorescent quantitative PCR detection reagent of Example 2.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com