Unlock instant, AI-driven research and patent intelligence for your innovation.
Primers and probes for detecting porcine infectious gastroenteritis virus, fluorescent quantitative PCR kit, method and application
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A fluorescent quantitative and detection reagent technology, applied in the field of virus PCR detection, can solve the problems of cumbersome operation, long detection time, insufficient specificity and sensitivity, etc., and achieve the effect of good repeatability, high sensitivity and strong specificity
Inactive Publication Date: 2019-01-18
SHANDONG NEW HOPE LIUHE GROUP
View PDF6 Cites 1 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
These conventional methods are cumbersome to operate and take a long time to detect, some need 5-7 days or even longer to produce results
In addition, these conventional methods have insufficient specificity and sensitivity when used for TGEV detection, especially when the virus content is low in the early stage of virus infection
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0056] Example 1 Primers and Probes
[0057] The embodiment of the present invention provides a primer and probe for specific detection of TGEV, wherein:
[0063] Example 2 Fluorescent quantitative PCR detection reagent
[0064] An embodiment of the present invention provides a fluorescent quantitative PCR detection reagent for detecting TGEV, which includes the following components: reaction mixture, water, and primers and probes for detecting TGEV; wherein,
[0070] The reaction mixture was Premix Ex Taq (Probe qPCR) produced by TaKaRa Company; the water was RNase-free Water produced by TaKaRa Company.
Embodiment 3
[0071] Example 3 Fluorescent quantitative PCR kit
[0072] The embodiment of the present invention provides a fluorescent quantitative PCR kit for preparing and detecting TGEV, specifically a kit containing the fluorescent quantitative PCR detection reagent of Example 2.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a primer and a probe for detecting porcine infectious gastroenteritisvirus, a fluorescent quantitative PCR kit, a method and application, wherein, nucleotide sequence of primis as follows: upstream prim: 5' TTGTCTGGGTTGCCAAGGAT 3', downstream primer: 5' TCATTATTAGCACCACGACTACCAA 3'; the sequence of the probe is as follows: 5' FAM-CCATGAACAAACCAAC-MGB 3'. The invention hasthe advantages that: the reagent kit of the invention can quickly and accurately realize the detection of the porcine infectious gastroenteritisvirus; the method is specific, sensitive and reproducible. The method and application provides a rapid and accurate method for the laboratory diagnosis and epidemiological investigation of porcine infectious gastroenteritisvirus.
Description
technical field [0001] The invention relates to the technical field of virus PCR detection, in particular to a primer and a probe for detecting porcine transmissible gastroenteritis virus, a fluorescent quantitative PCR kit, and a PCR detection system construction method and application. Background technique [0002] Porcine transmissible gastroenteritis virus (TGEV), belonging to the family Coronaviridae, is the causative agent of porcine transmissible gastroenteritis (TGE). TGE is a highly contagious enteric disease. Pigs of all ages are susceptible to infection and disease. It is especially characterized by vomiting, severe diarrhea and high mortality in piglets under 2 weeks of age. TGE occurs and prevails from time to time in some areas of my country, and TGEV is often mixed with other viruses, which is very harmful to my country's pig industry. The symptoms of diarrhea caused by TGEV-infected pigs are very similar to those of other porcine diarrhea-like viruses, and i...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More