Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers and probes for detecting porcine infectious gastroenteritis virus, fluorescent quantitative PCR kit, method and application

A fluorescent quantitative and detection reagent technology, applied in the field of virus PCR detection, can solve the problems of cumbersome operation, long detection time, insufficient specificity and sensitivity, etc., and achieve the effect of good repeatability, high sensitivity and strong specificity

Inactive Publication Date: 2019-01-18
SHANDONG NEW HOPE LIUHE GROUP
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These conventional methods are cumbersome to operate and take a long time to detect, some need 5-7 days or even longer to produce results
In addition, these conventional methods have insufficient specificity and sensitivity when used for TGEV detection, especially when the virus content is low in the early stage of virus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and probes for detecting porcine infectious gastroenteritis virus, fluorescent quantitative PCR kit, method and application
  • Primers and probes for detecting porcine infectious gastroenteritis virus, fluorescent quantitative PCR kit, method and application
  • Primers and probes for detecting porcine infectious gastroenteritis virus, fluorescent quantitative PCR kit, method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Primers and Probes

[0057] The embodiment of the present invention provides a primer and probe for specific detection of TGEV, wherein:

[0058] The primer sequences are as follows:

[0059] Upstream primer: 5'TTGTCTGGGTTGCCAAGGAT 3',

[0060] Downstream primer: 5' TCATTATTAGCACCACGACTACCAA 3';

[0061] The probe sequence is as follows:

[0062] 5' FAM-CCATGAACAAACCAAC-MGB 3'.

Embodiment 2

[0063] Example 2 Fluorescent quantitative PCR detection reagent

[0064] An embodiment of the present invention provides a fluorescent quantitative PCR detection reagent for detecting TGEV, which includes the following components: reaction mixture, water, and primers and probes for detecting TGEV; wherein,

[0065] The primer sequences are as follows:

[0066] Upstream primer: 5'TTGTCTGGGTTGCCAAGGAT 3',

[0067] Downstream primer: 5' TCATTATTAGCACCACGACTACCAA 3';

[0068] The probe sequence is as follows:

[0069] 5' FAM-CCATGAACAAACCAAC-MGB 3'.

[0070] The reaction mixture was Premix Ex Taq (Probe qPCR) produced by TaKaRa Company; the water was RNase-free Water produced by TaKaRa Company.

Embodiment 3

[0071] Example 3 Fluorescent quantitative PCR kit

[0072] The embodiment of the present invention provides a fluorescent quantitative PCR kit for preparing and detecting TGEV, specifically a kit containing the fluorescent quantitative PCR detection reagent of Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and a probe for detecting porcine infectious gastroenteritis virus, a fluorescent quantitative PCR kit, a method and application, wherein, nucleotide sequence of primis as follows: upstream prim: 5' TTGTCTGGGTTGCCAAGGAT 3', downstream primer: 5' TCATTATTAGCACCACGACTACCAA 3'; the sequence of the probe is as follows: 5' FAM-CCATGAACAAACCAAC-MGB 3'. The invention hasthe advantages that: the reagent kit of the invention can quickly and accurately realize the detection of the porcine infectious gastroenteritis virus; the method is specific, sensitive and reproducible. The method and application provides a rapid and accurate method for the laboratory diagnosis and epidemiological investigation of porcine infectious gastroenteritis virus.

Description

technical field [0001] The invention relates to the technical field of virus PCR detection, in particular to a primer and a probe for detecting porcine transmissible gastroenteritis virus, a fluorescent quantitative PCR kit, and a PCR detection system construction method and application. Background technique [0002] Porcine transmissible gastroenteritis virus (TGEV), belonging to the family Coronaviridae, is the causative agent of porcine transmissible gastroenteritis (TGE). TGE is a highly contagious enteric disease. Pigs of all ages are susceptible to infection and disease. It is especially characterized by vomiting, severe diarrhea and high mortality in piglets under 2 weeks of age. TGE occurs and prevails from time to time in some areas of my country, and TGEV is often mixed with other viruses, which is very harmful to my country's pig industry. The symptoms of diarrhea caused by TGEV-infected pigs are very similar to those of other porcine diarrhea-like viruses, and i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/701C12Q2563/107C12Q2545/114
Inventor 李晓菲秦立廷陈婷孙爱荣魏笑笑
Owner SHANDONG NEW HOPE LIUHE GROUP
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More