Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction and application of reinforced micromolecular antibody

A small molecule antibody, enhanced technology, applied in the field of biomedicine, can solve the problems of improper dosage, limited application and treatment range, and easy to cause adverse reactions.

Active Publication Date: 2019-01-25
武汉原生药谷生物医药科技有限公司
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

More importantly, protamine is commercially available and has been used as a clinical therapeutic drug. The current shortcomings: (1) the scope of application treatment is very limited; (2) when the dosage is used improperly, it is easy to cause adverse reactions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of reinforced micromolecular antibody
  • Construction and application of reinforced micromolecular antibody
  • Construction and application of reinforced micromolecular antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Embodiment 1 protamine cDNA and amino acid sequence

[0089] human protamine 1 mRNA

[0090] (A total of 304bp, of which the underline is the cDNA encoded amino acid sequence 156bp)

[0091] GACTCACAGCCCACAGAGTTCCACCTGCTCACAGGTTGGCTGGCTCAGCCAAGGTGGTGCCCTGCTCTGAGCATTCAGGCCAAGCCCATCCTGCACC ATGGCCAGGTACAGATGCTGTCGCAGCCAGAGCCGGAGCAGATATTACC GCCAGAGACAAAGAAGTCGCAGACGAAGGAGGCGGAGCTGCCAGACACGGAGGAGAGCCATGAGGTGCTGCCGCCCC AGGTACAGACCGCGATGTAGAAGACACTAA TTGCACAAAATAGCACATCCAAACTCCTGCCTGAGAATGTTACCAGACTTCAAGATCCTCTTGCCACATCTTGAAAATGCCACCATCCAATAAAAATCAGGAGCCTGCTAAGGAACAATGCCGCCTGTCAATAAATGTTGAAAAGTCATCCCAAAAAAAAAAAAAAAAAAA

[0092] Amino acid sequence of human protamine 1 (51aa)

[0093] MARYRCCRSQSRSRYYRQRQRSRRRRRRSCQTRRRAMRCCRPRYRPRCRRH

[0094] human protamine 2 mRNA

[0095] (A total of 651bp, of which the underline is 309bp of cDNA encoded amino acid sequence)

[0096] GGTGGGCAGGCCTCCGCCCTCTCCCCTACTCCAGGGCCCACTGCAGCCTCAGCCCAGGAGCCACCAGATCTCCCAACACC ATGGTCCGATACCGC...

Embodiment 2

[0104] Example 2 Construction and expression of enhanced small molecule antibody ((N-) anti-human CD19 heavy chain variable region antibody+anti-human CD19 light chain variable region antibody (C-)+human protamine 2+His6)

[0105] Basic pattern of enhanced small molecule antibody: Objective Enhanced small molecule antibody: (N-) anti-human CD19 heavy chain variable region antibody + anti-human CD19 light chain variable region antibody (C-) + human protamine 2 + His6 . Basic amplification conditions: 95°C for 5min, followed by 30 cycles of 95°C for 1min, 55°C for 1min, 72°C for 1min, and finally 72°C for 5min. EcoR I and BamH I restriction sites were introduced into the PCR primers. (N-) anti-human CD19 heavy chain variable region antibody+anti-human CD19 light chain variable region antibody (C-)+human protamine 2+His6 cDNA (enhanced small molecule antibody cDNA) was cloned into pMD18T / L19 expression plasmid , the correct sequence was obtained by sequencing.

[0106]The enha...

Embodiment 3

[0109] Example 3 Purification and Identification of Enhanced Small Molecule Antibody

[0110] To purify the expressed protein of interest, the pellet obtained from the medium was washed twice with buffer (20 mM Tris / HCl, pH 8.0, 3% (V / V) Triton X-100 and 1 M urea), and resuspended in 200 ml Denaturing buffer (20mM Tris / HCl, pH 8.0, 8M urea, 150mM NaCl, 10mM imidazole and 10mM 2-mercaptoethanol). Store at 25°C with gentle shaking to ensure complete dissolution of the osmosome. Proteins were purified by immobilized metal-ion-affinity chromatography (IMAC) under denaturing conditions. At 4°C, denature the mixture, 14000g x 20 minutes, and supernatant. Inclusion bodies were dissolved in a lysis buffer at a ratio of 20:1 (7M guanidine hydrochloride, 50mM Tris, 50mM NaCl, 5mM ethyldiaminotetraacetic acid, 50mM dithiothreitol, pH 8.0), 37°C, Incubate for 1 hour. After centrifugation, the supernatant was diluted (20 times) with refolding buffer (50mM Tr-HCl, 50mMNaCl, 0.8mM L-argi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Apertureaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of biological medicine, in particular to construction and application of a reinforced micromolecular antibody. According to the construction of the reinforced micromoleuclar antibody, disclosed by the invention, the functions of a micromolecular antibody can be increased; the application of the reinforced micromolecular antibody in clinical diseases hashigher value.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to the construction and application of an enhanced small molecule antibody. Background technique [0002] Miniaturization, humanization, and functionalization are the three main development trends of genetically engineered antibody drugs. Small molecule antibodies are mostly genetically engineered antibodies, which are miniaturized antibodies with a molecular weight of 20-30kDa, which is only 1 / 6 of the complete antibody molecule. Small molecule antibodies are mostly used clinically and are a kind of therapeutic antibody drug. Antibodies are divided into natural antibodies, polyclonal antibodies, monoclonal antibodies and genetically engineered antibodies. Antibodies such as IgG antibody molecules are composed of two V regions and C regions. When using genetic engineering technology to construct small molecule antibodies, we will face the problem of engineered anti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00A61K39/395A61K47/42A61P35/00A61P35/02A61P37/02A61P19/02A61P29/00A61P25/00
CPCA61K2039/505A61P19/02A61P25/00A61P29/00A61P35/00A61P35/02A61P37/02C07K14/461C07K16/18C07K16/241C07K16/2803C07K16/2887C07K2317/31C07K2317/622C07K2317/73C07K2317/734C07K2317/94C07K2319/21C07K2319/31
Inventor 刘东旭
Owner 武汉原生药谷生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com