Fusion TaqDNA polymerase and application thereof

A polymerase and single-strand binding protein technology, applied in the direction of recombinant DNA technology, applications, enzymes, etc., can solve the problems of DNA cross-contamination false positives, unfavorable, long-term, etc., and achieve the effect of stable enzyme activity

Active Publication Date: 2019-01-25
NANJING CHEST HOSPITAL
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Many reports have enhanced the amplification efficiency and specificity of Taq DNA polymerase through enzyme modification, but few reports have improved the amplification of Taq DNA polymerase in blood without purification.
The current amplification used in hospitals or industrial users is a huge number of samples. If DNA extraction and purification are to be performed first, and then amplified, it will take a long time on the one hand, and on the other hand, DNA cross-contamination may cause many false positives. Judgment of unfavorable results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion TaqDNA polymerase and application thereof
  • Fusion TaqDNA polymerase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1 prepares the Taq DNA polymerase of fusion

[0035] We have obtained three genes expressing DNA single-strand binding proteins: HMF, Sac7d, and sso7d, and their sequences can be obtained through existing public access, or SEQ ID NO.4, SEQ ID NO.1, and SEQ ID NO. The wild-type Taq DNA polymerase is removed from the sequence of 2, that is, the remaining sequence after removing the sequence of SEQ ID NO.3. The nucleic acid sequences of HMF, Sac7d, and sso7d were obtained through pre-amplification, gel recovery, and sequencing, and HMF, Sac7d, and sso7d were linked end-to-end with Taq using the ClonExpress Ultra One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd.) respectively in the pET28a vector , to obtain the recombinant gene, transform it into Escherichia coli, shake the bacteria at 37°C for 1 hour (rotating speed 200-250rpm), centrifuge at 5000rpm for 5min, discard 900μl supernatant, resuspend the bacteria in the remaining medium, and spread the ...

Embodiment 2

[0049] The improved Taq DNA polymerase that embodiment 2 detects is directly used in the effect of blood amplification

[0050] The effect of the modified HMF-Taq, Sac7d-Taq, sso7d-Taq and wild-type Taq (sequence shown in SEQ ID NO.3) on blood direct expansion was tested.

[0051] The reaction buffer formula used in the test: 30mM Tris, pH8.3, Mg 2.5mM, KCl 10mM, trehalose 0.5M, reaction enzyme concentration 2U / μl.

[0052] The blood template concentration was 15% of the reaction system. Reaction program: 95°C for 30 sec, 95°C for 5 min, 58°C for 30 sec, 72°C for 30 sec (35 cycles), 72°C for 5 min.

[0053] Primer sequences used for amplification:

[0054] R: CTGCCCGTAGTAGTCGTAATCGTCCTCCAT

[0055] F: AACTGCTGCTTGGCTACAGCGACATCGA

[0056] The PCR products were electrophoresed on a 1% agarose gel to obtain figure 1 The results show that Sac7d-Taq and sso7d-Taq obtained by gene fusion can be well amplified in a system containing 15% blood, while the comparative HMF-Taq and ...

Embodiment 3

[0057] Example 3 Detection of enzyme activities of HMF-Taq, Sac7d-Taq, sso7d-Taq and wild-type Taq in the presence of different concentrations of blood

[0058] Four enzymes (HMF-Taq, Sac7d-Taq, sso7d-Taq and wild-type Taq) composed of 3 enzymes prepared in Example 1 and wild-type Taq were mixed with activated calf thymus DNA and P 32 Incubate with labeled dATP, keep it at 70°C for 10 minutes under different volume concentrations of blood inhibition, detect the enzyme activity by detecting the speed of nucleotide infiltration into DNA, and detect it on a microplate reader, the results are shown in Table 1 As shown, it shows that the enzyme activity of Sac7d-Taq and sso7d-Taq obtained by gene fusion is stable in the presence of different blood, and 15% of blood can still maintain more than 90% of the activity, while the wild-type and HMF-Taq activities decrease respectively To 11%, 30%.

[0059] Table 1: 4 kinds of enzymes detect enzyme activity results under blood inhibition ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

To achieve the above object, the present invention discloses a fusion Taq DNA polymerase, which is formed by fusing a DNA single-strand binding protein Sac7d or a DNA single-strand binding protein sso7d with a wild-type Taq DNA polymerase, respectively. The Taq DNA polymerase provided by the invention enhances the affinity with the template chain in the amplification process so as to improve the amplification efficiency, realizes the amplification of difficult templates, has stable enzyme activity and can be directly amplified by using blood as a template.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to a fused Taq DNA polymerase and its application. Background technique [0002] PCR is the most basic but most important method in the field of molecular biology. It can replicate and expand trace amounts of nucleic acid, realize biological research, and greatly promote the development of molecular biology and related disciplines. The main components of PCR include: reaction buffer, enzyme, dNTP, template, and primers. Among these components, each component is indispensable for PCR amplification, but DNA polymerase is the key to realizing DNA replication. The transformation of enzymes enables more applications, such as: direct expansion of blood, direct expansion of soil, direct expansion of plants, etc. [0003] Taq DNA polymerase is a thermophilic DNA polymerase present in Thermus aquaticus, which can replicate DNA at 74°C and still have enzyme activity at 95°C. The enzyme can us...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/54C12N15/70C12N1/21C12Q1/686C12R1/19
CPCC07K14/00C12N9/1252C12Q1/686C12Y207/07007
Inventor张晨曦吴晓渊张斌
OwnerNANJING CHEST HOSPITAL