Isothermal fluorescent amplification primer set, probe, method and kit used for detecting African swine fever virus

A technology for African swine fever virus and amplification primers, which is applied in the field of constant temperature fluorescent amplification primer sets, probes, methods and kits, can solve the problems of complex operation, long time, and high technical requirements for operators, and achieve simple operation, High sensitivity and strong specificity

Pending Publication Date: 2020-05-01
INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI +2
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the methods for laboratory diagnosis of African swine fever include red blood cell adsorption test, direct / indirect immunofluorescence test, animal inoculation test, enzyme-linked immunosorbent assay, immunoelectrophoresis test, indirect enzyme-linked immunosorbent plaque test, etc.; however, existing technical methods The operation is complicated, the technical requirements for operators are high, the time is long, and samples cannot be tested in batches, so it is particularly important to establish a fast and accurate detection method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The design of embodiment 1 fluorescent type RAA primer set and probe

[0032] According to the 24 genotype reference strains of African swine fever virus and the p72 gene sequence of African swine fever virus isolated from China, the conserved regions were screened, and primers and probes were designed. The present invention screens out a group of primer pairs ASFV-F, ASFV-R and probe ASFV-P with high sensitivity and strong specificity for amplifying the African swine fever virus gene sequence through a large number of screenings. The nucleotide sequence is as follows:

[0033] ASFV-F: CAAGGTTCACGTTCTCRTTAAACCAAAAGCGC (SEQ ID NO: 1);

[0034] ASFV-R:

[0035] CTTAATCCAGAGCGCAAGAGGGGGCTGATAG[FAM-dT][THF][BHQ1-dT]TTAGGGGTTTGAGGY (SEQ ID NO: 2);

[0036] ASFV-P: FAM-GGAYGCAACGTATCTGGACATAAGACGTAATG-BHQ1 (SEQ ID NO: 3).

Embodiment 2

[0038] (1) Preparation of standard samples

[0039] The full-length p72 gene of the ASFV reference gene type II Chinese isolate (accession number: AF270706) was artificially synthesized and ligated into the pUC57 vector to obtain the vector of the African swine fever target sequence, which is the positive control of the African swine fever virus.

[0040] (2) Fluorescent RAA detection of positive control

[0041] With the positive standard substance prepared in step (1), the diluted plasmid standard substance is fluorescently carried out under optimal amplification conditions with the primer set ASFV-F, ASFV-R and the probe ASFV-P described in Example 1 Type RAA was amplified, and the pUC57 plasmid without the African swine fever virus gene fragment was used as a negative control.

[0042] The reaction system is: 1 μL of ASFV-F primer, 1 μL of ASFV-R primer, 1 μL of ASFV-P probe, and 42.5 μL of hydrolysis buffer (Buffer A) to dissolve the RAA reaction unit (lyophilized powder...

Embodiment 3

[0046] (1) Extract the DNA of tissue samples such as pig spleen and muscle, whole blood samples, feed samples, sewage, and feces samples to be tested.

[0047](2) Using the extracted DNA as a template, carry out fluorescent RAA amplification with the primer set described in Example 2 and the probe, and use the recombinant plasmid of Example 2 as a positive control to contain no African swine fever virus gene The plasmid of the fragment is a negative control;

[0048] The reaction system is: 1 μL of ASFV-F primer, 1 μL of ASFV-R primer, 1 μL of ASFV-P probe, and 42.5 μL of hydrolysis buffer (Buffer A) to dissolve the RAA reaction unit (lyophilized powder); magnesium acetate 2.5 μL (Buffer B), 5 μL of DNA template; the reaction program is: 42°C, 30 seconds, 40 cycles, collect the fluorescent signal, and obtain the Ct value.

[0049] (3) Result determination:

[0050] Positive control: a typical amplification curve appears, and the peak time ≤ 15min (Ct value ≤ 30);

[0051] N...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for detecting an African swine fever virus by isothermal fluorescent nucleic acid amplification. According to the method, by designing specific primers and the probe,a to-be-detected sample is amplified under the isothermal condition by utilizing a recombinase mediated chain-shuffling nucleic acid amplification technique, and detection of the African swine fever virus can be completed within 20 min. A kit has high sensitivity, and the lowest detection limit is 10 copies / muL, and the kit has high specificity, and thus, an effect technological means can be provided for on-site quick detecting and screening of the African swine fever virus.

Description

technical field [0001] The invention belongs to the field of virus detection, and in particular relates to a constant temperature fluorescent amplification primer set, probe, method and kit for detecting African swine fever virus. Background technique [0002] African swine fever has existed in sub-Saharan African countries since it was first reported in Kenya in 1921. It spread to Western Europe and Latin American countries in 1957, and most of them were extinguished in time, but in Portugal, southwestern Spain and Sardinia in Italy Still popular. Since 2007, African swine fever has occurred, spread, and spread in many countries around the world, especially in Russia and its surrounding areas. In March 2017, an African swine fever epidemic occurred in the Irkutsk region of the Far East of Russia. The epidemic occurred relatively close to my country, only about 1,000 kilometers away; The inventory and pork consumption rank first in the world. The total import volume of bree...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/701C12Q2521/507C12Q2522/101C12Q2563/107
Inventor 翟少伦王衡娄亚坤魏文康赵林萍付燕峰吕殿红龚浪温肖会翟颀
Owner INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap