Isothermal fluorescent amplification primer set, probe, method and kit used for detecting African swine fever virus
A technology for African swine fever virus and amplification primers, which is applied in the field of constant temperature fluorescent amplification primer sets, probes, methods and kits, can solve the problems of complex operation, long time, and high technical requirements for operators, and achieve simple operation, High sensitivity and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0031] The design of embodiment 1 fluorescent type RAA primer set and probe
[0032] According to the 24 genotype reference strains of African swine fever virus and the p72 gene sequence of African swine fever virus isolated from China, the conserved regions were screened, and primers and probes were designed. The present invention screens out a group of primer pairs ASFV-F, ASFV-R and probe ASFV-P with high sensitivity and strong specificity for amplifying the African swine fever virus gene sequence through a large number of screenings. The nucleotide sequence is as follows:
[0033] ASFV-F: CAAGGTTCACGTTCTCRTTAAACCAAAAGCGC (SEQ ID NO: 1);
[0034] ASFV-R:
[0035] CTTAATCCAGAGCGCAAGAGGGGGCTGATAG[FAM-dT][THF][BHQ1-dT]TTAGGGGTTTGAGGY (SEQ ID NO: 2);
[0036] ASFV-P: FAM-GGAYGCAACGTATCTGGACATAAGACGTAATG-BHQ1 (SEQ ID NO: 3).
Embodiment 2
[0038] (1) Preparation of standard samples
[0039] The full-length p72 gene of the ASFV reference gene type II Chinese isolate (accession number: AF270706) was artificially synthesized and ligated into the pUC57 vector to obtain the vector of the African swine fever target sequence, which is the positive control of the African swine fever virus.
[0040] (2) Fluorescent RAA detection of positive control
[0041] With the positive standard substance prepared in step (1), the diluted plasmid standard substance is fluorescently carried out under optimal amplification conditions with the primer set ASFV-F, ASFV-R and the probe ASFV-P described in Example 1 Type RAA was amplified, and the pUC57 plasmid without the African swine fever virus gene fragment was used as a negative control.
[0042] The reaction system is: 1 μL of ASFV-F primer, 1 μL of ASFV-R primer, 1 μL of ASFV-P probe, and 42.5 μL of hydrolysis buffer (Buffer A) to dissolve the RAA reaction unit (lyophilized powder...
Embodiment 3
[0046] (1) Extract the DNA of tissue samples such as pig spleen and muscle, whole blood samples, feed samples, sewage, and feces samples to be tested.
[0047](2) Using the extracted DNA as a template, carry out fluorescent RAA amplification with the primer set described in Example 2 and the probe, and use the recombinant plasmid of Example 2 as a positive control to contain no African swine fever virus gene The plasmid of the fragment is a negative control;
[0048] The reaction system is: 1 μL of ASFV-F primer, 1 μL of ASFV-R primer, 1 μL of ASFV-P probe, and 42.5 μL of hydrolysis buffer (Buffer A) to dissolve the RAA reaction unit (lyophilized powder); magnesium acetate 2.5 μL (Buffer B), 5 μL of DNA template; the reaction program is: 42°C, 30 seconds, 40 cycles, collect the fluorescent signal, and obtain the Ct value.
[0049] (3) Result determination:
[0050] Positive control: a typical amplification curve appears, and the peak time ≤ 15min (Ct value ≤ 30);
[0051] N...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com