Carrier protein, recombinant expression vector, exosome and preparation method and application of exosome

A technology for carrying proteins and expression vectors, applied in the biological field, can solve problems such as difficulties, and achieve the effects of good applicability, wide application range and stable process

Inactive Publication Date: 2019-02-01
JINAN UNIVERSITY
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for macromolecular protein drugs, it is very difficult to use the commonly used means of electroporation, transfection, incubation, etc. to load drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carrier protein, recombinant expression vector, exosome and preparation method and application of exosome
  • Carrier protein, recombinant expression vector, exosome and preparation method and application of exosome
  • Carrier protein, recombinant expression vector, exosome and preparation method and application of exosome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1 Contains the construction of the recombinant vector of carrier protein TPO1

[0060] Entrusted Suzhou Synbio Biotechnology Co., Ltd. to synthesize the carrier protein TP01 gene (SEQ ID NO.2), and added a polyclonal restriction site Ascl-KpnI-Xho (GGCGCGCC-GGTACC-CTCGAG) at the 3' end of the sequence, using To insert the target protein carried.

[0061] Design primers F-TP01 (Nde I) and R-TP01 (Hind III) according to the sequence of the TPO1 gene, so that the front of the amplified sequence has the Nde I restriction site of the pcDNA3.4 vector, and the end has the Hind III restriction site site, the template is the synthetic TPO1 gene sequence.

[0062] (1) Related sequence information

[0063] ①The gene sequence of the carrier protein TP01 is as follows (the italic bold part is the signal peptide):

[0064]

[0065]

[0066] ②Primer sequence information

[0067] F-TP01:

[0068] ATAAAA GCTAGC ATGCCGCGCCCCCGCCTGCTGGCC

[0069] R-TP01:

[0070]...

Embodiment 2

[0078] Example 2 Preparation of TPO1-EGFP fusion protein exosomes

[0079] 1. Construction of TP01-EGFP recombinant plasmid

[0080] Entrust Suzhou Synbio Biotechnology Co., Ltd. to synthesize the EGFP gene, and add a linker sequence (Linker sequence) to its N-terminal. Restriction sites are added to both ends of the Linker-EGFP gene, which can be connected with the carrier protein of the recombinant vector in Example 1. The carrier protein and the green fluorescent protein EGFP are fused and expressed in animal cells.

[0081] (1) Related sequence information

[0082] ① Linker sequence information

[0083] Nucleotide sequence:

[0084] gat agt gct ggt agt gct ggt agt gct ggt

[0085] Amino acid sequence:

[0086] DSAGSAGSAG

[0087] ② EGFP sequence information

[0088] Nucleotide sequence:

[0089] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCC...

Embodiment 3

[0123] Example 3 Transfection of 293T cells with exosomes containing TPO1-EGFP

[0124] Transfect blank 293T cells (purchased from Sangon Bioengineering (Shanghai) Co., Ltd.) with exosomes (containing TPO1-EGFP) extracted from step "3. Exosome extraction and detection" of Example 1, and laser Confocal microscope and flow cytometer for observation and detection.

[0125] (1) Laser confocal microscope observation: Blank 293T cells were added to a 6-well plate, and after 48 hours of culture, 1% (v / v) exosomes were added. After 48 hours of culture, the culture medium was discarded, and the cells were washed three times with PBS. , adding 4% paraformaldehyde (Beijing Dingguo Changsheng Biotechnology Co., Ltd., AR-0211) to fix at room temperature for 15 minutes, and washed three times with PBS. Add permeation solution 0.25% TritonX-100 (sigma; T9284-100ml) to incubate for 15min, wash with PBS three times. DAPI (Beyotime; C1005) was used for staining for 5 min, washed three times w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
particle diameteraaaaaaaaaa
Login to view more

Abstract

The invention provides carrier protein, recombinant expression vector, an exosome and a preparation method and application of the exosome. Foreign protein can be carried into the exosome efficiently through fusion of the carrier protein with the foreign protein. Through the recombinant expression vector, a to-be-expressed foreign protein peptide fragment gene sequence is inserted into polyclonal sites of the recombinant expression vector, so that efficient and directed expression of the foreign protein in the cell exosome is achieved; meanwhile, the invention also provides the preparation method of the exosome for carrying the foreign protein, foreign gene can be brought into the exosome effectively, and simple and easy operation, a stable process and good applicability are achieved; and the exosome prepared by using the preparation method contains the foreign protein, has good cell permeability and highly efficiency of cell transfection, the activity and efficacy of the foreign protein can be developed at the same time, and a broad application prospect is achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a carrier protein, a recombinant expression vector, exosomes and a preparation method and application thereof. Background technique [0002] In 1981, Trams et al. discovered a group of vesicle-like substances with a diameter of 40-1000 nm that were smaller than multivesicular bodies under a transmission electron microscope. In 1987, Johnstone et al. named this kind of membrane vesicles as exosomes. This kind of vesicles is formed by the depression of the cytoplasmic membrane, so the outer membrane and the cell membrane are the same substance, and the ligand-receptor interaction, cytoplasmic Enter recipient cells by drinking / phagocytosis or membrane fusion. Naturally formed exosomes themselves can carry a large number of components such as RNA, protein, etc. These characteristics lead to the idea of ​​using exosomes naturally produced by such cells as a drug delivery sys...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/00C07K19/00C12N15/11A61K47/42
CPCA61K47/42C07K14/00C07K14/485C07K14/503C07K2319/055
Inventor 谢秋玲熊盛王凯季煜华
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap