Carrier protein, recombinant expression vector, exosome and preparation method and application of exosome
A technology for carrying proteins and expression vectors, applied in the biological field, can solve problems such as difficulties, and achieve the effects of good applicability, wide application range and stable process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Embodiment 1 Contains the construction of the recombinant vector of carrier protein TPO1
[0060] Entrusted Suzhou Synbio Biotechnology Co., Ltd. to synthesize the carrier protein TP01 gene (SEQ ID NO.2), and added a polyclonal restriction site Ascl-KpnI-Xho (GGCGCGCC-GGTACC-CTCGAG) at the 3' end of the sequence, using To insert the target protein carried.
[0061] Design primers F-TP01 (Nde I) and R-TP01 (Hind III) according to the sequence of the TPO1 gene, so that the front of the amplified sequence has the Nde I restriction site of the pcDNA3.4 vector, and the end has the Hind III restriction site site, the template is the synthetic TPO1 gene sequence.
[0062] (1) Related sequence information
[0063] ①The gene sequence of the carrier protein TP01 is as follows (the italic bold part is the signal peptide):
[0064]
[0065]
[0066] ②Primer sequence information
[0067] F-TP01:
[0068] ATAAAA GCTAGC ATGCCGCGCCCCCGCCTGCTGGCC
[0069] R-TP01:
[0070]...
Embodiment 2
[0078] Example 2 Preparation of TPO1-EGFP fusion protein exosomes
[0079] 1. Construction of TP01-EGFP recombinant plasmid
[0080] Entrust Suzhou Synbio Biotechnology Co., Ltd. to synthesize the EGFP gene, and add a linker sequence (Linker sequence) to its N-terminal. Restriction sites are added to both ends of the Linker-EGFP gene, which can be connected with the carrier protein of the recombinant vector in Example 1. The carrier protein and the green fluorescent protein EGFP are fused and expressed in animal cells.
[0081] (1) Related sequence information
[0082] ① Linker sequence information
[0083] Nucleotide sequence:
[0084] gat agt gct ggt agt gct ggt agt gct ggt
[0085] Amino acid sequence:
[0086] DSAGSAGSAG
[0087] ② EGFP sequence information
[0088] Nucleotide sequence:
[0089] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCC...
Embodiment 3
[0123] Example 3 Transfection of 293T cells with exosomes containing TPO1-EGFP
[0124] Transfect blank 293T cells (purchased from Sangon Bioengineering (Shanghai) Co., Ltd.) with exosomes (containing TPO1-EGFP) extracted from step "3. Exosome extraction and detection" of Example 1, and laser Confocal microscope and flow cytometer for observation and detection.
[0125] (1) Laser confocal microscope observation: Blank 293T cells were added to a 6-well plate, and after 48 hours of culture, 1% (v / v) exosomes were added. After 48 hours of culture, the culture medium was discarded, and the cells were washed three times with PBS. , adding 4% paraformaldehyde (Beijing Dingguo Changsheng Biotechnology Co., Ltd., AR-0211) to fix at room temperature for 15 minutes, and washed three times with PBS. Add permeation solution 0.25% TritonX-100 (sigma; T9284-100ml) to incubate for 15min, wash with PBS three times. DAPI (Beyotime; C1005) was used for staining for 5 min, washed three times w...
PUM
Property | Measurement | Unit |
---|---|---|
particle diameter | aaaaa | aaaaa |
particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap