Phospholipase c and its encoding gene

A phospholipase, coding technology, applied in the direction of genetic engineering, plant genetic improvement, enzymes, etc., can solve problems such as affecting the quality of edible oil and inedible

Active Publication Date: 2021-08-31
WILMAR SHANGHAI BIOTECH RES & DEV CENT
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In the manufacture of vegetable edible oils, the crude oil extracted from oilseeds by pressing and leaching generally contains impurities such as proteins, sterols, phospholipids, pigments, trace metals, and free fatty acids, which affect the quality of edible oils. usually inedible

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phospholipase c and its encoding gene
  • Phospholipase c and its encoding gene
  • Phospholipase c and its encoding gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Embodiment 1: Construction of expression vector pAO-mPLC

[0077] In the way of whole gene synthesis (Shanghai Sangong), the variant BC-PC-PLC sequence mPLC (see SEQ ID NO: 1) with Y56H, N63D, N131S, and N134D mutations was synthesized. A fragment of approximately 750 bp was amplified by PCR using PrimeSTAR® HS DNA Polymerase and the primer pair PLC-F / PLC-R (see Table 1). The about 750 bp fragment was cloned into pAO815 through HindIII and EcoRI restriction sites to obtain pAO-mPLC vector.

[0078] Table 1 Primer sequences

[0079] Primer name sequence PLC-F CTGAAGCTTGGTCAGCTGAGGACAAGCAT (SEQ ID NO: 5) PLC-R CCGGAATTCTTACCTGTCACCGTAAGTGTCGAACCATA (SEQ ID NO: 6)

Embodiment 2

[0080] Example 2: Construction and screening of pAO-mPLC mutant library

[0081] Using the pAO-mPLC vector as a template, use TaKaRa Taq enzyme and primers to perform error-prone PCR on PLC-F / PLC-R (see Table 1) (additional 0.3 mM MnCl 2 ), a collection of mutant amplicon fragments with a size of about 755 bp was obtained. The obtained fragment was cloned into pAO815 through the HindIII and EcoRI restriction sites, and the obtained vector was transformed into E. coli DH5α strain to obtain a total of 1 × 10 4 mutants.

[0082] Will each 1×10 3 Each pAO-mPLC mutant was washed with 2 ml of sterile water into 8 ml of LB liquid medium (containing 100 μg / ml ampicillin), and incubated at 37°C for 4 h. The plasmid was extracted, linearized with restriction endonuclease SalI, and a fragment of about 8.5 kb was recovered. Take 500 ng of the vector (use as little DNA as possible to ensure that most positive transformants contain a single copy of the PLC gene), and transform the vecto...

Embodiment 3

[0083] Example 3: Sequence analysis of pAO-mPLC mutants

[0084] The m2 strain was inoculated in 3 ml YPD liquid medium, cultivated overnight at 30°C, and the genomic DNA was extracted. Using the genomic DNA of the m2 strain as a template, use PrimeSTAR® HS DNA polymerase and primers to perform PCR amplification on PLC-F / PLC-R (see Table 1) to obtain the DNA sequence of the PLC in the m2 strain. The obtained sequence was sent to Shanghai Sangon Bioengineering Co., Ltd., and the PLC-F / PLC-R (see Table 1) was sequenced with primers. According to the DNA sequencing results of the PLC of m2, one base was mutated, and the 10th glycine was mutated to aspartic acid (GGT→GAT).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to phospholipase C and its coding gene. It also relates to vectors and host cells comprising said genes. In addition, it also relates to the method for producing the phospholipase C and the use of the phospholipase C.

Description

technical field [0001] The invention relates to a novel phospholipase C and its coding gene. It also relates to vectors and host cells comprising said genes. In addition, it also relates to the method for producing the phospholipase C and the use of the phospholipase C. Background technique [0002] In the manufacture of vegetable edible oils, crude oil extracted from oilseeds by pressing and leaching generally contains impurities such as proteins, sterols, phospholipids, pigments, trace metals, and free fatty acids, which affect the quality of edible oils. Usually inedible. Therefore, oil refining is required. Degumming is a very important part of the vegetable oil refining process. In recent years, enzymatic degumming technology has attracted widespread attention in the market due to its mild reaction conditions, high refining yield, environmental protection and wide application range. [0003] Phospholipases are a class of enzymes that are widely found in animals, pl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/16C12N15/55C12N15/81C11B3/00
CPCC11B3/003C12N9/16C12N15/815C12Y301/04003C11B3/00
Inventor吴伟戴小军曹海生牛其文
OwnerWILMAR SHANGHAI BIOTECH RES & DEV CENT